ID: 919650914

View in Genome Browser
Species Human (GRCh38)
Location 1:200148099-200148121
Sequence CTTTGAGAAGGTGCAGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 898
Summary {0: 1, 1: 0, 2: 5, 3: 47, 4: 845}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919650914_919650920 2 Left 919650914 1:200148099-200148121 CCCACTGCTGCACCTTCTCAAAG 0: 1
1: 0
2: 5
3: 47
4: 845
Right 919650920 1:200148124-200148146 CTCCTTGCCCACGCTGGAGGAGG 0: 2
1: 0
2: 0
3: 26
4: 243
919650914_919650918 -1 Left 919650914 1:200148099-200148121 CCCACTGCTGCACCTTCTCAAAG 0: 1
1: 0
2: 5
3: 47
4: 845
Right 919650918 1:200148121-200148143 GTCCTCCTTGCCCACGCTGGAGG 0: 2
1: 0
2: 2
3: 13
4: 185
919650914_919650924 13 Left 919650914 1:200148099-200148121 CCCACTGCTGCACCTTCTCAAAG 0: 1
1: 0
2: 5
3: 47
4: 845
Right 919650924 1:200148135-200148157 CGCTGGAGGAGGTGTCCAAGAGG 0: 1
1: 1
2: 1
3: 11
4: 158
919650914_919650917 -4 Left 919650914 1:200148099-200148121 CCCACTGCTGCACCTTCTCAAAG 0: 1
1: 0
2: 5
3: 47
4: 845
Right 919650917 1:200148118-200148140 AAAGTCCTCCTTGCCCACGCTGG 0: 2
1: 0
2: 0
3: 12
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919650914 Original CRISPR CTTTGAGAAGGTGCAGCAGT GGG (reversed) Intronic