ID: 919658870

View in Genome Browser
Species Human (GRCh38)
Location 1:200223713-200223735
Sequence CCAAAGCCTGGACTTTCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919658870_919658876 -2 Left 919658870 1:200223713-200223735 CCACAAGAAAGTCCAGGCTTTGG No data
Right 919658876 1:200223734-200223756 GGAGGCCAGGGTAATGAGTTTGG No data
919658870_919658878 19 Left 919658870 1:200223713-200223735 CCACAAGAAAGTCCAGGCTTTGG No data
Right 919658878 1:200223755-200223777 GGATTTTATTCTAAGTGCAGTGG No data
919658870_919658879 20 Left 919658870 1:200223713-200223735 CCACAAGAAAGTCCAGGCTTTGG No data
Right 919658879 1:200223756-200223778 GATTTTATTCTAAGTGCAGTGGG 0: 4
1: 14
2: 94
3: 313
4: 893

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919658870 Original CRISPR CCAAAGCCTGGACTTTCTTG TGG (reversed) Intergenic
No off target data available for this crispr