ID: 919659979 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:200234791-200234813 |
| Sequence | CAACCTAAAGACTCTACAGG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 919659974_919659979 | 29 | Left | 919659974 | 1:200234739-200234761 | CCTATCAGAGGGAGAAGCAGAAT | No data | ||
| Right | 919659979 | 1:200234791-200234813 | CAACCTAAAGACTCTACAGGTGG | No data | ||||
| 919659977_919659979 | -8 | Left | 919659977 | 1:200234776-200234798 | CCAACATGTAAGCATCAACCTAA | No data | ||
| Right | 919659979 | 1:200234791-200234813 | CAACCTAAAGACTCTACAGGTGG | No data | ||||
| 919659975_919659979 | 5 | Left | 919659975 | 1:200234763-200234785 | CCTAGAAACTCCACCAACATGTA | No data | ||
| Right | 919659979 | 1:200234791-200234813 | CAACCTAAAGACTCTACAGGTGG | No data | ||||
| 919659976_919659979 | -5 | Left | 919659976 | 1:200234773-200234795 | CCACCAACATGTAAGCATCAACC | No data | ||
| Right | 919659979 | 1:200234791-200234813 | CAACCTAAAGACTCTACAGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 919659979 | Original CRISPR | CAACCTAAAGACTCTACAGG TGG | Intergenic | ||
| No off target data available for this crispr | |||||