ID: 919659979

View in Genome Browser
Species Human (GRCh38)
Location 1:200234791-200234813
Sequence CAACCTAAAGACTCTACAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919659974_919659979 29 Left 919659974 1:200234739-200234761 CCTATCAGAGGGAGAAGCAGAAT No data
Right 919659979 1:200234791-200234813 CAACCTAAAGACTCTACAGGTGG No data
919659977_919659979 -8 Left 919659977 1:200234776-200234798 CCAACATGTAAGCATCAACCTAA No data
Right 919659979 1:200234791-200234813 CAACCTAAAGACTCTACAGGTGG No data
919659975_919659979 5 Left 919659975 1:200234763-200234785 CCTAGAAACTCCACCAACATGTA No data
Right 919659979 1:200234791-200234813 CAACCTAAAGACTCTACAGGTGG No data
919659976_919659979 -5 Left 919659976 1:200234773-200234795 CCACCAACATGTAAGCATCAACC No data
Right 919659979 1:200234791-200234813 CAACCTAAAGACTCTACAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919659979 Original CRISPR CAACCTAAAGACTCTACAGG TGG Intergenic
No off target data available for this crispr