ID: 919666386

View in Genome Browser
Species Human (GRCh38)
Location 1:200296834-200296856
Sequence CAGAGCTCACCCTTTTAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919666386_919666391 5 Left 919666386 1:200296834-200296856 CCACCTTAAAAGGGTGAGCTCTG No data
Right 919666391 1:200296862-200296884 CAAGGACCAAGAGATCAAACTGG No data
919666386_919666394 12 Left 919666386 1:200296834-200296856 CCACCTTAAAAGGGTGAGCTCTG No data
Right 919666394 1:200296869-200296891 CAAGAGATCAAACTGGGAGATGG No data
919666386_919666392 6 Left 919666386 1:200296834-200296856 CCACCTTAAAAGGGTGAGCTCTG No data
Right 919666392 1:200296863-200296885 AAGGACCAAGAGATCAAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919666386 Original CRISPR CAGAGCTCACCCTTTTAAGG TGG (reversed) Intergenic
No off target data available for this crispr