ID: 919666391

View in Genome Browser
Species Human (GRCh38)
Location 1:200296862-200296884
Sequence CAAGGACCAAGAGATCAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919666386_919666391 5 Left 919666386 1:200296834-200296856 CCACCTTAAAAGGGTGAGCTCTG No data
Right 919666391 1:200296862-200296884 CAAGGACCAAGAGATCAAACTGG No data
919666387_919666391 2 Left 919666387 1:200296837-200296859 CCTTAAAAGGGTGAGCTCTGCCG No data
Right 919666391 1:200296862-200296884 CAAGGACCAAGAGATCAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919666391 Original CRISPR CAAGGACCAAGAGATCAAAC TGG Intergenic
No off target data available for this crispr