ID: 919666392

View in Genome Browser
Species Human (GRCh38)
Location 1:200296863-200296885
Sequence AAGGACCAAGAGATCAAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919666387_919666392 3 Left 919666387 1:200296837-200296859 CCTTAAAAGGGTGAGCTCTGCCG No data
Right 919666392 1:200296863-200296885 AAGGACCAAGAGATCAAACTGGG No data
919666386_919666392 6 Left 919666386 1:200296834-200296856 CCACCTTAAAAGGGTGAGCTCTG No data
Right 919666392 1:200296863-200296885 AAGGACCAAGAGATCAAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919666392 Original CRISPR AAGGACCAAGAGATCAAACT GGG Intergenic
No off target data available for this crispr