ID: 919666394

View in Genome Browser
Species Human (GRCh38)
Location 1:200296869-200296891
Sequence CAAGAGATCAAACTGGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919666387_919666394 9 Left 919666387 1:200296837-200296859 CCTTAAAAGGGTGAGCTCTGCCG No data
Right 919666394 1:200296869-200296891 CAAGAGATCAAACTGGGAGATGG No data
919666386_919666394 12 Left 919666386 1:200296834-200296856 CCACCTTAAAAGGGTGAGCTCTG No data
Right 919666394 1:200296869-200296891 CAAGAGATCAAACTGGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919666394 Original CRISPR CAAGAGATCAAACTGGGAGA TGG Intergenic
No off target data available for this crispr