ID: 919669300

View in Genome Browser
Species Human (GRCh38)
Location 1:200324331-200324353
Sequence GGCTGAACTCAGTTCCTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919669300_919669301 -4 Left 919669300 1:200324331-200324353 CCTGCAAGGAACTGAGTTCAGCC No data
Right 919669301 1:200324350-200324372 AGCCAAAGACCATGTTAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919669300 Original CRISPR GGCTGAACTCAGTTCCTTGC AGG (reversed) Intergenic
No off target data available for this crispr