ID: 919674031

View in Genome Browser
Species Human (GRCh38)
Location 1:200363651-200363673
Sequence TTATAGATAAAGATTGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919674031_919674035 23 Left 919674031 1:200363651-200363673 CCTACTTCAATCTTTATCTATAA No data
Right 919674035 1:200363697-200363719 AAACTTTCTTTCTGATTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919674031 Original CRISPR TTATAGATAAAGATTGAAGT AGG (reversed) Intergenic
No off target data available for this crispr