ID: 919675696

View in Genome Browser
Species Human (GRCh38)
Location 1:200380538-200380560
Sequence CCACCTGGCTGGTTTCTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919675696_919675710 22 Left 919675696 1:200380538-200380560 CCCTAAAGAAACCAGCCAGGTGG No data
Right 919675710 1:200380583-200380605 AGCCTCTACTACTATTTCCAGGG No data
919675696_919675704 -7 Left 919675696 1:200380538-200380560 CCCTAAAGAAACCAGCCAGGTGG No data
Right 919675704 1:200380554-200380576 CAGGTGGTTCCATGGGGATCTGG No data
919675696_919675709 21 Left 919675696 1:200380538-200380560 CCCTAAAGAAACCAGCCAGGTGG No data
Right 919675709 1:200380582-200380604 GAGCCTCTACTACTATTTCCAGG No data
919675696_919675705 -6 Left 919675696 1:200380538-200380560 CCCTAAAGAAACCAGCCAGGTGG No data
Right 919675705 1:200380555-200380577 AGGTGGTTCCATGGGGATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919675696 Original CRISPR CCACCTGGCTGGTTTCTTTA GGG (reversed) Intergenic
No off target data available for this crispr