ID: 919676142

View in Genome Browser
Species Human (GRCh38)
Location 1:200385494-200385516
Sequence CTGACTACACATGTGTAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919676141_919676142 -7 Left 919676141 1:200385478-200385500 CCGAGGGAAGTTTGAACTGACTA No data
Right 919676142 1:200385494-200385516 CTGACTACACATGTGTAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919676142 Original CRISPR CTGACTACACATGTGTAACC TGG Intergenic
No off target data available for this crispr