ID: 919676828

View in Genome Browser
Species Human (GRCh38)
Location 1:200392315-200392337
Sequence CTCGAAAGAGCTCAAGCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919676828_919676836 25 Left 919676828 1:200392315-200392337 CCCTGGGCTTGAGCTCTTTCGAG No data
Right 919676836 1:200392363-200392385 GGCTGGATCTTGAACACAGTGGG No data
919676828_919676835 24 Left 919676828 1:200392315-200392337 CCCTGGGCTTGAGCTCTTTCGAG No data
Right 919676835 1:200392362-200392384 AGGCTGGATCTTGAACACAGTGG No data
919676828_919676830 -3 Left 919676828 1:200392315-200392337 CCCTGGGCTTGAGCTCTTTCGAG No data
Right 919676830 1:200392335-200392357 GAGACCATGATGCTGAAACTTGG No data
919676828_919676833 8 Left 919676828 1:200392315-200392337 CCCTGGGCTTGAGCTCTTTCGAG No data
Right 919676833 1:200392346-200392368 GCTGAAACTTGGTGCCAGGCTGG No data
919676828_919676832 4 Left 919676828 1:200392315-200392337 CCCTGGGCTTGAGCTCTTTCGAG No data
Right 919676832 1:200392342-200392364 TGATGCTGAAACTTGGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919676828 Original CRISPR CTCGAAAGAGCTCAAGCCCA GGG (reversed) Intergenic