ID: 919679137

View in Genome Browser
Species Human (GRCh38)
Location 1:200416978-200417000
Sequence AAGTTGTTGGCTGGGGGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919679137_919679144 17 Left 919679137 1:200416978-200417000 CCACCGCCCCCAGCCAACAACTT No data
Right 919679144 1:200417018-200417040 TAGCTTCAAGATAATGCAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919679137 Original CRISPR AAGTTGTTGGCTGGGGGCGG TGG (reversed) Intergenic