ID: 919679138

View in Genome Browser
Species Human (GRCh38)
Location 1:200416981-200417003
Sequence ATGAAGTTGTTGGCTGGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919679138_919679144 14 Left 919679138 1:200416981-200417003 CCGCCCCCAGCCAACAACTTCAT No data
Right 919679144 1:200417018-200417040 TAGCTTCAAGATAATGCAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919679138 Original CRISPR ATGAAGTTGTTGGCTGGGGG CGG (reversed) Intergenic