ID: 919679141

View in Genome Browser
Species Human (GRCh38)
Location 1:200416986-200417008
Sequence GAGTTATGAAGTTGTTGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919679141_919679144 9 Left 919679141 1:200416986-200417008 CCCAGCCAACAACTTCATAACTC No data
Right 919679144 1:200417018-200417040 TAGCTTCAAGATAATGCAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919679141 Original CRISPR GAGTTATGAAGTTGTTGGCT GGG (reversed) Intergenic