ID: 919679143

View in Genome Browser
Species Human (GRCh38)
Location 1:200416991-200417013
Sequence CTTAAGAGTTATGAAGTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919679143_919679144 4 Left 919679143 1:200416991-200417013 CCAACAACTTCATAACTCTTAAG No data
Right 919679144 1:200417018-200417040 TAGCTTCAAGATAATGCAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919679143 Original CRISPR CTTAAGAGTTATGAAGTTGT TGG (reversed) Intergenic
No off target data available for this crispr