ID: 919679144

View in Genome Browser
Species Human (GRCh38)
Location 1:200417018-200417040
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919679140_919679144 10 Left 919679140 1:200416985-200417007 CCCCAGCCAACAACTTCATAACT No data
Right 919679144 1:200417018-200417040 TAGCTTCAAGATAATGCAATTGG No data
919679142_919679144 8 Left 919679142 1:200416987-200417009 CCAGCCAACAACTTCATAACTCT No data
Right 919679144 1:200417018-200417040 TAGCTTCAAGATAATGCAATTGG No data
919679143_919679144 4 Left 919679143 1:200416991-200417013 CCAACAACTTCATAACTCTTAAG No data
Right 919679144 1:200417018-200417040 TAGCTTCAAGATAATGCAATTGG No data
919679138_919679144 14 Left 919679138 1:200416981-200417003 CCGCCCCCAGCCAACAACTTCAT No data
Right 919679144 1:200417018-200417040 TAGCTTCAAGATAATGCAATTGG No data
919679141_919679144 9 Left 919679141 1:200416986-200417008 CCCAGCCAACAACTTCATAACTC No data
Right 919679144 1:200417018-200417040 TAGCTTCAAGATAATGCAATTGG No data
919679137_919679144 17 Left 919679137 1:200416978-200417000 CCACCGCCCCCAGCCAACAACTT No data
Right 919679144 1:200417018-200417040 TAGCTTCAAGATAATGCAATTGG No data
919679139_919679144 11 Left 919679139 1:200416984-200417006 CCCCCAGCCAACAACTTCATAAC No data
Right 919679144 1:200417018-200417040 TAGCTTCAAGATAATGCAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type