ID: 919683057

View in Genome Browser
Species Human (GRCh38)
Location 1:200455040-200455062
Sequence CTGTGCAAGATGAGACTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919683057_919683059 -4 Left 919683057 1:200455040-200455062 CCTTCCAGTCTCATCTTGCACAG No data
Right 919683059 1:200455059-200455081 ACAGTCCTTGCTTTCAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919683057 Original CRISPR CTGTGCAAGATGAGACTGGA AGG (reversed) Intergenic
No off target data available for this crispr