ID: 919683059

View in Genome Browser
Species Human (GRCh38)
Location 1:200455059-200455081
Sequence ACAGTCCTTGCTTTCAGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919683058_919683059 -8 Left 919683058 1:200455044-200455066 CCAGTCTCATCTTGCACAGTCCT No data
Right 919683059 1:200455059-200455081 ACAGTCCTTGCTTTCAGCTCTGG No data
919683054_919683059 11 Left 919683054 1:200455025-200455047 CCTGACGCCCGTGTACCTTCCAG No data
Right 919683059 1:200455059-200455081 ACAGTCCTTGCTTTCAGCTCTGG No data
919683051_919683059 21 Left 919683051 1:200455015-200455037 CCCTATCCAGCCTGACGCCCGTG No data
Right 919683059 1:200455059-200455081 ACAGTCCTTGCTTTCAGCTCTGG No data
919683055_919683059 4 Left 919683055 1:200455032-200455054 CCCGTGTACCTTCCAGTCTCATC No data
Right 919683059 1:200455059-200455081 ACAGTCCTTGCTTTCAGCTCTGG No data
919683057_919683059 -4 Left 919683057 1:200455040-200455062 CCTTCCAGTCTCATCTTGCACAG No data
Right 919683059 1:200455059-200455081 ACAGTCCTTGCTTTCAGCTCTGG No data
919683056_919683059 3 Left 919683056 1:200455033-200455055 CCGTGTACCTTCCAGTCTCATCT No data
Right 919683059 1:200455059-200455081 ACAGTCCTTGCTTTCAGCTCTGG No data
919683053_919683059 15 Left 919683053 1:200455021-200455043 CCAGCCTGACGCCCGTGTACCTT No data
Right 919683059 1:200455059-200455081 ACAGTCCTTGCTTTCAGCTCTGG No data
919683052_919683059 20 Left 919683052 1:200455016-200455038 CCTATCCAGCCTGACGCCCGTGT No data
Right 919683059 1:200455059-200455081 ACAGTCCTTGCTTTCAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919683059 Original CRISPR ACAGTCCTTGCTTTCAGCTC TGG Intergenic
No off target data available for this crispr