ID: 919684000

View in Genome Browser
Species Human (GRCh38)
Location 1:200464700-200464722
Sequence AAATAGCTACAGATTTAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919683998_919684000 24 Left 919683998 1:200464653-200464675 CCTCTTGATTTCATAGCTATGGA No data
Right 919684000 1:200464700-200464722 AAATAGCTACAGATTTAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919684000 Original CRISPR AAATAGCTACAGATTTAGCC AGG Intergenic
No off target data available for this crispr