ID: 919687857

View in Genome Browser
Species Human (GRCh38)
Location 1:200500964-200500986
Sequence CAAGTCTTACAGCGTGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919687854_919687857 29 Left 919687854 1:200500912-200500934 CCTCCATGGCTACTGGTCAGCAA No data
Right 919687857 1:200500964-200500986 CAAGTCTTACAGCGTGCAGCTGG No data
919687855_919687857 26 Left 919687855 1:200500915-200500937 CCATGGCTACTGGTCAGCAACAA No data
Right 919687857 1:200500964-200500986 CAAGTCTTACAGCGTGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919687857 Original CRISPR CAAGTCTTACAGCGTGCAGC TGG Intergenic
No off target data available for this crispr