ID: 919690778

View in Genome Browser
Species Human (GRCh38)
Location 1:200526886-200526908
Sequence CTGGCTAACTACCCATCTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919690773_919690778 19 Left 919690773 1:200526844-200526866 CCACACAAAGCTTGACAAATTGG No data
Right 919690778 1:200526886-200526908 CTGGCTAACTACCCATCTGCCGG No data
919690772_919690778 27 Left 919690772 1:200526836-200526858 CCTCAGGGCCACACAAAGCTTGA No data
Right 919690778 1:200526886-200526908 CTGGCTAACTACCCATCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919690778 Original CRISPR CTGGCTAACTACCCATCTGC CGG Intergenic
No off target data available for this crispr