ID: 919690800

View in Genome Browser
Species Human (GRCh38)
Location 1:200526978-200527000
Sequence GGTGCGGGTGTCAGAGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919690800_919690806 16 Left 919690800 1:200526978-200527000 CCTGCAGCTCTGACACCCGCACC No data
Right 919690806 1:200527017-200527039 AGCCAAGCTCCGAGAAGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919690800 Original CRISPR GGTGCGGGTGTCAGAGCTGC AGG (reversed) Intergenic