ID: 919690895

View in Genome Browser
Species Human (GRCh38)
Location 1:200527504-200527526
Sequence CTTCAGACACAGCTGGATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919690890_919690895 5 Left 919690890 1:200527476-200527498 CCCAAAAGTCCAGAAGAGCAAAT No data
Right 919690895 1:200527504-200527526 CTTCAGACACAGCTGGATCCAGG No data
919690889_919690895 15 Left 919690889 1:200527466-200527488 CCTCATGTAACCCAAAAGTCCAG No data
Right 919690895 1:200527504-200527526 CTTCAGACACAGCTGGATCCAGG No data
919690892_919690895 -4 Left 919690892 1:200527485-200527507 CCAGAAGAGCAAATCCTCTCTTC No data
Right 919690895 1:200527504-200527526 CTTCAGACACAGCTGGATCCAGG No data
919690891_919690895 4 Left 919690891 1:200527477-200527499 CCAAAAGTCCAGAAGAGCAAATC No data
Right 919690895 1:200527504-200527526 CTTCAGACACAGCTGGATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919690895 Original CRISPR CTTCAGACACAGCTGGATCC AGG Intergenic
No off target data available for this crispr