ID: 919697208

View in Genome Browser
Species Human (GRCh38)
Location 1:200589841-200589863
Sequence CAGGGGCAATGTAGGGAAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 216}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919697208_919697217 -3 Left 919697208 1:200589841-200589863 CCGGTTTCCCTACATTGCCCCTG 0: 1
1: 0
2: 1
3: 19
4: 216
Right 919697217 1:200589861-200589883 CTGGCTGGTCTTGAACTCCTGGG 0: 132
1: 9529
2: 19685
3: 30563
4: 28402
919697208_919697219 20 Left 919697208 1:200589841-200589863 CCGGTTTCCCTACATTGCCCCTG 0: 1
1: 0
2: 1
3: 19
4: 216
Right 919697219 1:200589884-200589906 CTCAAGTAATCTGCCCGCCTTGG 0: 123
1: 4132
2: 24562
3: 56876
4: 97591
919697208_919697216 -4 Left 919697208 1:200589841-200589863 CCGGTTTCCCTACATTGCCCCTG 0: 1
1: 0
2: 1
3: 19
4: 216
Right 919697216 1:200589860-200589882 CCTGGCTGGTCTTGAACTCCTGG 0: 216
1: 18509
2: 39586
3: 59481
4: 53305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919697208 Original CRISPR CAGGGGCAATGTAGGGAAAC CGG (reversed) Intronic
900664134 1:3802675-3802697 CAAGGACGATGTAGAGAAACTGG + Intergenic
900917620 1:5649867-5649889 CAGTTGCAATGTGGGGTAACAGG - Intergenic
904128883 1:28260739-28260761 CAGGGGCTTTGCAGGGAGACCGG + Intronic
904358061 1:29954250-29954272 CGGGGGGAATGGAGGGAGACTGG + Intergenic
905207749 1:36352619-36352641 CAGGGGGAAGGGAGGGAAACAGG - Intronic
906246628 1:44280365-44280387 CAGTGGAAATGTAGAGAAATGGG - Intronic
906282427 1:44563408-44563430 CAGGGCCAAGGGAGGGAAGCGGG - Intronic
906327149 1:44853792-44853814 AAGGTGCACTGTTGGGAAACTGG + Intronic
906721159 1:48005763-48005785 CAGGGTGATTGTAGTGAAACTGG + Intergenic
908111818 1:60905386-60905408 CAGGGGCAAAGAAGGAACACTGG - Intronic
909012910 1:70354418-70354440 CAGGGGCAAGGGGGGGAATCGGG + Exonic
911583236 1:99659509-99659531 CTGGGGAAATTTAGGGAAGCAGG + Intronic
916529430 1:165641724-165641746 CAGGGGCTATGTATGAATACAGG + Intronic
916647235 1:166797773-166797795 CAGGGGCCGGGTGGGGAAACAGG + Intergenic
917981172 1:180270416-180270438 CAGGGGCACTGTGGAGAAAAGGG + Intronic
918796480 1:188904268-188904290 CAGAGGCAATGTACGTAAACTGG + Intergenic
919690670 1:200525960-200525982 CAGAGGCAATGAGGGTAAACTGG + Intergenic
919697208 1:200589841-200589863 CAGGGGCAATGTAGGGAAACCGG - Intronic
919896350 1:202011931-202011953 CAAGGGCCAGGCAGGGAAACAGG - Intronic
922202910 1:223421555-223421577 CAGTGGCAGTGCAGGGGAACAGG - Intergenic
922853016 1:228750182-228750204 AAGGGGCAGAGTAGGAAAACAGG - Intergenic
924468036 1:244315594-244315616 CTGGGGCAATTTAGGGCAAGGGG + Intergenic
924643683 1:245857501-245857523 AAGGGGCAACGTAGGACAACAGG - Intronic
1063297839 10:4825404-4825426 CAGGGCCAGTGGAGGGAAAGAGG - Intronic
1063589785 10:7385054-7385076 CAGGGGCAATCCAGGTGAACTGG - Intronic
1063878834 10:10509922-10509944 CAAGGTCAATGTAGGGTCACTGG - Intergenic
1065945133 10:30599307-30599329 CAGGGGCTATGAAGGGACAAAGG - Intergenic
1066068594 10:31781198-31781220 CAGGTGAATTGAAGGGAAACAGG + Intergenic
1067429349 10:46232847-46232869 CAGCTGCGATGTTGGGAAACAGG - Intergenic
1070542346 10:77425311-77425333 GAGGGGGCATTTAGGGAAACTGG - Intronic
1071707639 10:88016550-88016572 AAGGGACAATGTAGAGAAACTGG + Intergenic
1074577710 10:114686070-114686092 CAGGGGCAAAGTGGGGGAGCAGG + Intergenic
1078553430 11:12296649-12296671 CAGGGACAAGGAAGGGAAAGAGG - Intronic
1079582320 11:22080913-22080935 CAGTGGCAATGTAGTTAAAGAGG - Intergenic
1080666046 11:34337257-34337279 CAGGGGCTGTGTAGGGAAGGAGG + Intronic
1081676900 11:44975295-44975317 GATGGGCAGTGTAGGGAGACAGG + Intergenic
1082820062 11:57538589-57538611 CAGGGCCTTTGTAGGGACACTGG + Intergenic
1084340334 11:68494476-68494498 GAAGGGGAATATAGGGAAACAGG - Intronic
1084522768 11:69674759-69674781 CAGGGGCTCTGGAGGGAAAAGGG + Intronic
1084828971 11:71753555-71753577 CAAGAGCAGTTTAGGGAAACGGG + Intergenic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1085855168 11:80168168-80168190 CAGGGGCAATGTGAGAAAAGAGG - Intergenic
1087214011 11:95475520-95475542 CAGGCTCACTGCAGGGAAACTGG - Intergenic
1087451928 11:98334700-98334722 CAGGGGCAATGGGGGAGAACAGG - Intergenic
1087955564 11:104282785-104282807 CAGGGGTAATGGAGGGAATAAGG - Intergenic
1088919824 11:114252733-114252755 CACGAGGAATGTAGGGAAGCCGG + Intergenic
1088937244 11:114415134-114415156 CAAGGCAAATGTAGAGAAACTGG + Intronic
1089171715 11:116516286-116516308 CATGGGTGATGTAGGGACACAGG + Intergenic
1091708027 12:2713216-2713238 CAGGGACAATGTAGGAAATGAGG - Intergenic
1092414262 12:8278132-8278154 CAAGAGCAGTTTAGGGAAACGGG - Intergenic
1095302784 12:40606145-40606167 CAGTGAAAATGTAGAGAAACTGG + Intergenic
1096295874 12:50383632-50383654 TAGGGGGAATGTAGGGATAAAGG - Intronic
1096387480 12:51204383-51204405 CAGGGGCACTGTTGGGATAGGGG + Intronic
1098953533 12:76665816-76665838 CAGAGGCAATGTCAGGAAAGAGG - Intergenic
1101546964 12:105722930-105722952 CAGGGGCAATGGGAGGAAACTGG + Intergenic
1102642554 12:114379728-114379750 CAGGGTCCATGGATGGAAACAGG - Intronic
1105932648 13:25067343-25067365 TGGGGACAATTTAGGGAAACAGG - Intergenic
1106699808 13:32217319-32217341 CAGGGGCAGTGTGGGCAAAATGG - Intronic
1106764075 13:32896220-32896242 CAGGGGAAAAGTGGGAAAACAGG - Intergenic
1108077672 13:46698422-46698444 AAGCGGCAATGTAGTGACACTGG - Intronic
1108708957 13:53014991-53015013 CAGAGGCTCTGTGGGGAAACTGG + Intergenic
1112144702 13:96685772-96685794 CTGGGTCAATGAAGGAAAACGGG - Intronic
1114744251 14:25130553-25130575 AAGGGGCAATTTAGGAAAATAGG + Intergenic
1114744373 14:25132077-25132099 AAGGGGCAATTTAGGAAAATAGG + Intergenic
1115466941 14:33725700-33725722 CAGTGGCAATGAAAGGCAACAGG - Intronic
1117320880 14:54622349-54622371 CAGGGCCTATCTAGGGAAGCAGG + Intronic
1118073466 14:62271450-62271472 CTGGGGCTAAGTGGGGAAACTGG - Intergenic
1119218570 14:72888171-72888193 TAGGGGCAATGTGTGGAAGCAGG - Intronic
1120884674 14:89442387-89442409 CAGGTTCAATCTTGGGAAACAGG + Intronic
1122234971 14:100326242-100326264 CAGGGGCTGGGTAGGGAGACAGG + Intronic
1123028643 14:105440268-105440290 CATGTGGACTGTAGGGAAACAGG + Intronic
1123952490 15:25294958-25294980 CTGGGGGAATGTAGAGAAAAGGG + Intergenic
1124356195 15:28996582-28996604 CAGCGGCTTTGTAGGGAAACTGG + Intronic
1125053544 15:35330427-35330449 GAGGGGCAAAGTAAGGAATCTGG + Intronic
1125244521 15:37619550-37619572 CATGGTCACTGCAGGGAAACTGG + Intergenic
1125896325 15:43305444-43305466 CAGGAGCAAAGTGGGGAAAATGG + Intergenic
1126292748 15:47099977-47099999 CAGGGGCAGTGTAGGGGAATTGG + Intergenic
1127258586 15:57311191-57311213 CTGGGGCCATGCTGGGAAACAGG + Intergenic
1128892757 15:71345347-71345369 CAGGGGCAAGGTAGGGCCAAAGG + Intronic
1129320772 15:74773451-74773473 CAGGGACAATGTTGGCACACAGG + Intergenic
1129321239 15:74776239-74776261 CAGTTGCTAGGTAGGGAAACAGG + Intergenic
1130991850 15:88880231-88880253 CAGGGGCAGCCTAGAGAAACAGG - Intronic
1131880823 15:96860164-96860186 CAGGGGCTCTGTGGGAAAACGGG + Intergenic
1131904220 15:97124497-97124519 CAGGAGAAATGTAGGCAAAATGG + Intergenic
1132966965 16:2662014-2662036 CATGGACGATGTAGAGAAACTGG + Intergenic
1135574354 16:23573820-23573842 CAGGGGCAGAGAAGGGAAAGGGG + Exonic
1135589546 16:23695226-23695248 CCAGGGCAATGTAGTGGAACTGG + Exonic
1136121300 16:28136962-28136984 CAGGGACACTGGAGGGAGACTGG + Intronic
1136363904 16:29799657-29799679 CAGGGGCAATGTTGGCAATAAGG - Exonic
1137575664 16:49598463-49598485 CAGAAGCAGTGAAGGGAAACAGG + Intronic
1138137160 16:54533060-54533082 CAGGGGCTAGGTAGGGAAACAGG + Intergenic
1138722007 16:59092973-59092995 CAGGTGCAATGTGGGGAGACAGG - Intergenic
1141165440 16:81657594-81657616 CAGGGGCAAGGTCGGGAAGGGGG - Intronic
1142030499 16:87836116-87836138 CAGGAGGAATGCAGGGAACCCGG - Intronic
1143137621 17:4720518-4720540 CAGGGCCAGTGGAGGAAAACTGG + Intronic
1146372284 17:32272626-32272648 CAGGAGTAAGGTAGGGAAGCAGG - Intronic
1153561253 18:6374072-6374094 CAGGGGAAATGTGGGCAACCAGG - Intronic
1153734755 18:8054380-8054402 GAGGGGAAATGTAGAAAAACAGG - Intronic
1155916783 18:31565132-31565154 CAGAGGCATTTTAGGAAAACAGG + Intergenic
1157305697 18:46515863-46515885 CAGGGACAAAATAGGGAAGCTGG - Intronic
1157859156 18:51125306-51125328 AAGGGGCAAGGTAGGTAAGCAGG + Intergenic
1158559922 18:58505162-58505184 CAGGGGCAGGGCAGGGAGACCGG + Intronic
1158801039 18:60909657-60909679 CAGTGAGAATGTAGAGAAACAGG + Intergenic
1160820783 19:1056765-1056787 CAGGGGCAATTTAGGGATGAGGG - Intronic
1161267565 19:3371723-3371745 CAGAGGGAAGGGAGGGAAACTGG - Intronic
1161349786 19:3785299-3785321 CAGGGGCAGGGTGGGGAAATAGG + Intronic
1161707427 19:5828746-5828768 CAGCGACAATCTGGGGAAACTGG - Intergenic
1163321014 19:16574793-16574815 CAGCTGCAATGCAGGGAGACAGG - Intronic
925820979 2:7799624-7799646 CAGGGGCCATGCAGGGCAGCTGG - Intergenic
928069709 2:28202374-28202396 CAGGGGCATGGGAGGGAAGCAGG - Intronic
931752955 2:65346965-65346987 CAAGGGCATTGGAAGGAAACAGG - Intronic
932537426 2:72614340-72614362 CAGGGGCAGGGCAGGGAACCAGG + Intronic
932617021 2:73239097-73239119 CAGCTGCAGTGTAGGAAAACAGG - Intronic
933213268 2:79596307-79596329 CAGAGTCAAGGTAGGGAAAATGG + Intronic
935456198 2:103270192-103270214 CAGGGCTGATGTGGGGAAACTGG - Intergenic
936284787 2:111173577-111173599 CAGGCGCAGTGTAGGGGCACAGG - Intergenic
936490659 2:112969284-112969306 CAGGTGGATTGTAGGGCAACAGG + Intergenic
937170732 2:119864747-119864769 CAGAATGAATGTAGGGAAACAGG + Intronic
939692282 2:145279105-145279127 CAAGGGCAATGTGGCAAAACTGG - Intergenic
940534555 2:154924128-154924150 TAGGGGCAATGAAAGAAAACAGG - Intergenic
940995231 2:160142475-160142497 CATGGGCAATGAGGGGAATCAGG + Intronic
943238535 2:185354785-185354807 CAAGGTCAAAGTAGGGAAAGAGG - Intergenic
943299492 2:186180159-186180181 CAGGGGCAGTAGAGGGAGACAGG - Intergenic
945792331 2:214320408-214320430 CAGGAGGAATGTAGACAAACAGG - Intronic
946419902 2:219558815-219558837 CAGAGGCAAGGCAGGGAAAGGGG - Intronic
1172518228 20:35550669-35550691 CAGGGGCATTGTAGGGACTCGGG + Intronic
1173191528 20:40880450-40880472 CAGGGGCACTAGAGGGAGACTGG + Intergenic
1173655846 20:44699826-44699848 CAGGGCCACTGCTGGGAAACAGG - Intergenic
1175539115 20:59737160-59737182 CAGGGGCTATGATGGGAAAGGGG - Intronic
1175553398 20:59831357-59831379 CAGGGACCAGGTAGGGAGACCGG + Intronic
1176046054 20:63093151-63093173 CAGGAGCAATCTCGGGAAACAGG + Intergenic
1178880002 21:36441911-36441933 CAGGTGCCATGAAGGGAAAGTGG - Intergenic
1179299690 21:40095527-40095549 CAGGGGCAGGGTAGGGGAAGGGG + Intronic
1181164411 22:20975782-20975804 CAGGGTCAAGGGTGGGAAACAGG + Intronic
1181795263 22:25303916-25303938 CGGGGGCAATGTGGGGGAACTGG - Intergenic
1181835804 22:25607441-25607463 CGGGGGCAATGTGGGGGAACTGG - Intronic
1183094262 22:35542677-35542699 GAGGGGCAGTGCAGTGAAACAGG + Intronic
1183363560 22:37395558-37395580 CAGGGGCACTCTAGGGAGAGAGG + Intronic
1185170493 22:49290934-49290956 CAGGGGCAGTGTCGGGGAGCAGG + Intergenic
953396215 3:42572587-42572609 CAGAGGCCACGTAGGGAACCTGG + Intronic
955682261 3:61514531-61514553 GAGGGACAATGCAGGGAAAGAGG + Intergenic
956998755 3:74859172-74859194 CAGAGGCTATGTAGAGAGACAGG + Intergenic
959495702 3:107048863-107048885 CAGGTGCAGGGTAGGGAAAGAGG + Intergenic
960737716 3:120798907-120798929 CAGAGGGAATGTGGGGAAAAGGG - Intergenic
961579808 3:127871429-127871451 CAGGTGCCATGTCGGGAATCCGG + Intergenic
961638325 3:128349057-128349079 TAGGGGCCATGTGGGGAAACAGG + Intronic
961891814 3:130136755-130136777 CAAGAGCAGTTTAGGGAAACGGG - Intergenic
962532102 3:136291974-136291996 CAGGGCTGATGTAGGAAAACCGG - Intronic
962719125 3:138156194-138156216 AAAGGGCAATGGAGGGATACTGG - Intergenic
962850035 3:139301511-139301533 CAGAGGGAATGAAGGGAAGCTGG - Intronic
965377695 3:167946418-167946440 CAGGGGAAAAGTAGGTAAATTGG + Intergenic
966276794 3:178182574-178182596 CTGGGGCAGTCTGGGGAAACTGG + Intergenic
969750823 4:9109339-9109361 CAAGAGCAGTTTAGGGAAACGGG + Intergenic
969926044 4:10586810-10586832 CAAGTGCCATGTAGGCAAACTGG - Intronic
970501301 4:16679830-16679852 CAGGGTCAGTGCAGGGAGACTGG + Intronic
970504007 4:16708441-16708463 CAGGGGCAATATGGGTAGACAGG - Intronic
972375782 4:38468894-38468916 CTGGGGCAAAGTAGGAAATCAGG - Intergenic
973015396 4:45131063-45131085 AAGTGGCAATGAAGGGAAGCTGG - Intergenic
975844471 4:78510623-78510645 CAGAGGCAATGTAGGTCACCAGG - Intronic
977106582 4:92893385-92893407 CAGGGGCATGGTGGGGAAATAGG + Intronic
980919632 4:139070237-139070259 CAGGGGCCATGTAGGGAGCCAGG - Intronic
981639121 4:146915207-146915229 AGGAGGCAATGTAGGGAAATGGG - Intronic
982015289 4:151147411-151147433 TAGGAGAAATGTAGGGAAAGAGG - Intronic
984203802 4:176761683-176761705 CATGTATAATGTAGGGAAACTGG - Intronic
985143085 4:186863176-186863198 CAGGTGCAATGTAGAGAAGTGGG - Intergenic
985730993 5:1548815-1548837 CAGCGACAATGTAGAAAAACAGG - Intergenic
985843822 5:2329726-2329748 CAGGGGCCATCCTGGGAAACCGG + Intergenic
986230504 5:5860408-5860430 CAGGGTCCAAGGAGGGAAACAGG + Intergenic
987206080 5:15627439-15627461 CTGGGTCCATGTAGGGAAAATGG + Intronic
989470464 5:41811462-41811484 AAGAGGCAATGTAGAGAAAGAGG + Intronic
990756716 5:59079901-59079923 CAGGGGCAAGGCAAGGAAAGGGG + Intronic
992319936 5:75603886-75603908 CAGGGTCTTTGTAGGGAAACAGG - Intergenic
993560595 5:89402590-89402612 CAGGGGCAACAAAGGGAGACAGG + Intergenic
993724975 5:91356450-91356472 CAATGGTAATGGAGGGAAACGGG + Intergenic
994667513 5:102723694-102723716 TAGGGGCAATGTAGGATAAAGGG + Intergenic
996619695 5:125485059-125485081 CAGAGGCAATTTAAGGAAACAGG + Intergenic
997429457 5:133827415-133827437 CAGGGGCAGTGTTGGGAGGCAGG - Intergenic
997676295 5:135715482-135715504 AAGGGGCAATGCTGGGAAAGGGG - Intergenic
998677697 5:144428023-144428045 CAAGGGCTATGAAGGGAAAGAGG - Intronic
999710619 5:154315276-154315298 CACGGGCAATAGAGGGAAATGGG + Intronic
1001558744 5:172655339-172655361 GAGGGGGAAAGGAGGGAAACAGG - Intronic
1001651352 5:173318339-173318361 CAGGGGCAATGCTGGGAAGGAGG + Intronic
1002307513 5:178292518-178292540 GAGGGGCAATGTGGGGCAATTGG + Intronic
1003169432 6:3709477-3709499 CTTGAGCAATGTAGGGAAGCAGG + Intergenic
1003516171 6:6820892-6820914 CAGGGGCAATGCAGGGGAGAGGG + Intergenic
1003983532 6:11412358-11412380 CAGGGGCAAAGGAGGGAAATGGG + Intergenic
1004899119 6:20177944-20177966 CAGGAGGAATTTAGGGGAACTGG - Intronic
1010233902 6:73559129-73559151 AAGGGGCAAGGTAGGGAATGAGG - Intergenic
1011856617 6:91701075-91701097 GAGGGTCATTGTAGGGAAAGAGG + Intergenic
1016842013 6:148534155-148534177 CAAGGGCAGTGTTGGAAAACTGG - Intronic
1020322155 7:6947295-6947317 CAAGAGCAGTTTAGGGAAACGGG - Intergenic
1021888552 7:25164773-25164795 CAGGGGGAAGGTTGGGAAAGGGG - Intronic
1021905795 7:25331825-25331847 CAGGGGCTTTGAAGGCAAACAGG + Intergenic
1022238991 7:28490743-28490765 CAGGGGCAATGTGGGCCCACAGG - Intronic
1026224954 7:68432077-68432099 GAGGCACAAGGTAGGGAAACTGG - Intergenic
1029509044 7:100981810-100981832 AAGGGGCAATGGAGGGACAGAGG - Intronic
1029513467 7:101011211-101011233 CAGGGGCAAGGTTGGGGCACCGG - Intronic
1030023186 7:105295606-105295628 CAGGGGCCAGGAAGGGAAAATGG + Intronic
1030627583 7:111860637-111860659 CAGGGCCAGCGTAGGGAAGCTGG - Intronic
1030849821 7:114470150-114470172 CAGGGGCCATGCAGGGAGCCAGG - Intronic
1034383229 7:150717192-150717214 AAGGGGCCATGCAGGGAAAGGGG - Intronic
1036107829 8:5860568-5860590 CAGGCGGAAAGTGGGGAAACAGG + Intergenic
1037772301 8:21809668-21809690 CAGGGGCCAGGTAGGGAACTGGG - Intronic
1038416942 8:27404039-27404061 CCTGGGCAATGTATAGAAACTGG - Intronic
1039312281 8:36330174-36330196 CAGGGGCATTGTAACTAAACAGG + Intergenic
1040122143 8:43695342-43695364 CAAGGTCTATTTAGGGAAACAGG + Intergenic
1042745875 8:72104846-72104868 CAGGGGCTATGTAGGGGAAGTGG + Intronic
1042893407 8:73638130-73638152 CAGGGGCAAAATTGGGTAACTGG + Intronic
1042939428 8:74092294-74092316 AGGGGGCAATGTGGGGATACTGG - Intergenic
1044959376 8:97515391-97515413 CAGAGGCAAGGCAGGGTAACTGG + Intergenic
1045544443 8:103115752-103115774 CTTGGGCAATAGAGGGAAACTGG + Intergenic
1046001631 8:108427248-108427270 CAGGAGCAATGTAGAGGAATGGG - Intronic
1046873544 8:119229198-119229220 CAGGGACAAGGAAGGGATACGGG - Intronic
1046938668 8:119910147-119910169 CAGGGGCTACATTGGGAAACAGG + Intronic
1048044100 8:130756961-130756983 AGGAGGCAAAGTAGGGAAACAGG + Intergenic
1048612349 8:136036951-136036973 CAGGGACTATTTAGGGAGACAGG + Intergenic
1048898198 8:139013652-139013674 CTGGGGCTATGAAGGGAACCTGG + Intergenic
1049908586 9:243659-243681 CAGGGGAAAGGTAGGGAAGAAGG - Intronic
1052088392 9:24295843-24295865 CAGGGGCAGTGTAGGGTGCCAGG - Intergenic
1055379274 9:75688615-75688637 CAGATGCAATGTAAGGAAAAGGG + Intergenic
1055741104 9:79390566-79390588 CTGGGCCAATGTAGGTTAACTGG - Intergenic
1056242135 9:84658408-84658430 CAGGGGCAAAGTAGAGAAAATGG - Intergenic
1060196710 9:121628678-121628700 CAGGGGCAGGGGAGGGAAAGCGG + Intronic
1060519539 9:124286634-124286656 CAGGAGCACTGCAAGGAAACAGG - Intronic
1060677445 9:125528315-125528337 CAGTGGCCATCAAGGGAAACAGG - Intronic
1060778312 9:126392873-126392895 CAGGGACAATGTTGGGACAAGGG + Intronic
1062583538 9:137238548-137238570 CAAGGGCAAAGTAGGCAAGCTGG + Intergenic
1188697722 X:33216445-33216467 GAGGGGGAATGGAGGGAAGCGGG + Intronic
1196850824 X:119937015-119937037 CAGGGAAAAAGTAGAGAAACAGG + Intronic
1199494449 X:148437575-148437597 CATGGCCAATGCAGGGACACTGG + Intergenic
1199777777 X:151030628-151030650 CAAGGGCAGTGTAGAGAAAGTGG + Intergenic
1199996372 X:153029101-153029123 CTGGGGCTATGCAGGGAAACTGG - Intergenic
1200012109 X:153127109-153127131 CAGGGACCCTGCAGGGAAACAGG - Intergenic
1200027491 X:153272810-153272832 CAGGGACCCTGCAGGGAAACAGG + Intergenic
1200034812 X:153320348-153320370 CTGGGGCTGTGCAGGGAAACTGG + Intergenic
1200141378 X:153904585-153904607 CTGGGGAAAGGAAGGGAAACAGG + Intronic
1200947803 Y:8864007-8864029 AAGTGGCTATGTATGGAAACTGG - Intergenic