ID: 919697367

View in Genome Browser
Species Human (GRCh38)
Location 1:200591628-200591650
Sequence ACACTCTCCCAGTCTTCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 221}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919697367 Original CRISPR ACACTCTCCCAGTCTTCCTC TGG Intronic
900432049 1:2607089-2607111 TCACTCTCCCAGCCTCCCTGTGG + Intronic
902277142 1:15347966-15347988 ACACTCGCCAGGCCTTCCTCTGG - Intronic
903707310 1:25295751-25295773 ACACTCTCCCTTTCTTGCTGTGG - Intronic
903719931 1:25397591-25397613 ACACTCTCCCTTTCTTGCTGCGG + Intronic
905242803 1:36591943-36591965 CCACTCTCCCAGTTTGCCTCAGG + Intergenic
905345568 1:37308966-37308988 ACAACCTCCAAGTCTCCCTCAGG + Intergenic
905914542 1:41675708-41675730 AAACTCTCCTGGTCTTCCTAGGG - Intronic
907593869 1:55701993-55702015 TCCCTCCCCAAGTCTTCCTCAGG - Intergenic
907990110 1:59572594-59572616 ACAGACTCCCAGTCTTCTTCTGG - Intronic
908169541 1:61491155-61491177 CCACTCTCCCACTCATCCACCGG - Intergenic
909137328 1:71817693-71817715 ACACTCTACCAGGTTTCCACAGG - Intronic
910096508 1:83528523-83528545 ACACTCTCCATGCCTTCCACAGG + Intergenic
912034036 1:105288177-105288199 TCACACTCCCAGTCTTCTTTTGG + Intergenic
912362266 1:109104603-109104625 ACGCTCTCCCAGTCTTCCCAGGG - Intergenic
913177257 1:116286212-116286234 ACACTCCCCCAGTGCCCCTCAGG - Intergenic
914397256 1:147281961-147281983 CCACTCTCCTAGTATTTCTCAGG + Intronic
914764310 1:150624511-150624533 CCACTTTCCCAGCCTACCTCTGG - Intronic
917136913 1:171796681-171796703 AACCCCTCCCAGGCTTCCTCAGG - Exonic
917948563 1:180003726-180003748 ACCCTCTCCCAGTCTTCCATGGG - Intronic
918317940 1:183338889-183338911 AGACTCTCCCACTCTGTCTCGGG + Intronic
918394855 1:184103144-184103166 ACTCTTTCCCTGTCTTCCTTTGG - Intergenic
919697367 1:200591628-200591650 ACACTCTCCCAGTCTTCCTCTGG + Intronic
923498114 1:234542367-234542389 CCACTGTCCCACTCTCCCTCTGG + Intergenic
1063060513 10:2546412-2546434 AAACTATCCCCGTCTTCCTTGGG - Intergenic
1063236198 10:4119086-4119108 ACTCTCACCCAGTCTTGCACAGG - Intergenic
1064950234 10:20840355-20840377 TGACTCTCCCAGTCTTGCCCTGG - Intronic
1068053455 10:51981921-51981943 ACACTCTCCCTGTCTCCTTCAGG + Intronic
1070312085 10:75281307-75281329 ATACTCTCCAAATCTTCTTCAGG - Intergenic
1070673306 10:78393268-78393290 ACTCTCTCCCTTTCTGCCTCAGG - Intergenic
1071028862 10:81147983-81148005 ACACTCTTCTAGTTTTCCTAAGG - Intergenic
1071985760 10:91048632-91048654 ACACAGTCCCCGTCTTCCTGGGG - Intergenic
1073595216 10:104792814-104792836 AGACTCCCACAGTCTTCCTGGGG - Intronic
1074162812 10:110847789-110847811 ACACTCTCACACTCTTTCTGGGG + Intergenic
1075965425 10:126607203-126607225 ACACTTTTCCTGGCTTCCTCAGG - Intronic
1076138368 10:128060488-128060510 CCACTCTCCCAGGCTTCCCAGGG - Intronic
1077231501 11:1459938-1459960 ACCCTCTCCCTGTCATCCACTGG + Intronic
1078191759 11:9096931-9096953 TATCACTCCCAGTCTTCCTCAGG + Intronic
1079279083 11:19072109-19072131 CGACTTTCCCAGTCTTCCACAGG + Intergenic
1081582349 11:44360873-44360895 ACACTCTCCAGGTCTTGCTTGGG - Intergenic
1083160127 11:60849538-60849560 ACAGTCTCCCCCTCTTCCCCTGG - Intronic
1083580717 11:63823494-63823516 ACACTCTCCCCATCCTCCTCTGG - Intronic
1083721771 11:64607085-64607107 ACCCTCTCCCTGGCTGCCTCAGG - Exonic
1084777135 11:71384745-71384767 ACACCATCCCAGTCTCCATCTGG - Intergenic
1085318041 11:75557830-75557852 TCCCTCTCTCAGGCTTCCTCTGG - Intergenic
1085517020 11:77117508-77117530 CCACTTTGCCAGTCTTGCTCAGG + Intronic
1085823703 11:79820305-79820327 ACTCTCTCCGAGTCTGCCCCAGG - Intergenic
1088341133 11:108768467-108768489 ACCAACTCCCACTCTTCCTCAGG - Intronic
1089180302 11:116579102-116579124 CCACTCTCCAAGGCTTTCTCTGG - Intergenic
1089920151 11:122202261-122202283 ACACTTTCCCTTTCTTCCTTCGG - Intergenic
1090981115 11:131723300-131723322 ACACTCTCCCATCCATCATCAGG - Intronic
1091751000 12:3021095-3021117 ACACTGTCCCAGCCTCTCTCTGG + Intronic
1092252237 12:6905971-6905993 ACAGTCTCACAGTCCTCATCTGG - Intronic
1092954251 12:13534939-13534961 CCAGTCTCCCAGGCTCCCTCTGG + Intergenic
1094526983 12:31237764-31237786 ACAGTCTCCCAGGTTTTCTCAGG - Intergenic
1095902298 12:47340638-47340660 ACACTCTCTCCATCTTCTTCAGG - Intergenic
1096878528 12:54648639-54648661 AACCTCTCACAGTCTTCCCCAGG - Intergenic
1097266991 12:57751853-57751875 CCCCGCTCCCAGTCTTCCTTGGG + Intronic
1097399070 12:59107906-59107928 ACCCTCTCCCAGTAGTGCTCAGG + Intergenic
1099249502 12:80235700-80235722 GCCTTCTGCCAGTCTTCCTCTGG - Intronic
1101156894 12:101936163-101936185 ACACCCTCCCTGTGTTCGTCAGG - Intronic
1101315725 12:103627202-103627224 GCACTGCCCCAGTCTGCCTCTGG + Intronic
1101509282 12:105378329-105378351 TTCCTGTCCCAGTCTTCCTCTGG - Intronic
1102408973 12:112700577-112700599 ACACTCTCCGAGTCTGCACCTGG + Intronic
1104718928 12:131033921-131033943 ACCCTCTGCCAGTCCTCCCCGGG + Intronic
1106440525 13:29763138-29763160 CCACTCCCCCAGTGTTTCTCAGG - Intergenic
1107817807 13:44259818-44259840 ACACTCACCCATTCATCCCCTGG - Intergenic
1112748052 13:102550567-102550589 TCATTCTCCCACTCTTCCTCCGG + Intergenic
1113716568 13:112512891-112512913 ACACTTTCTTAGTTTTCCTCTGG - Intronic
1120078129 14:80183403-80183425 ACATTCTTCAAGTCTTCCTTTGG - Intergenic
1120299751 14:82691571-82691593 CCACTTTCCCAGCCTACCTCTGG - Intergenic
1120704570 14:87733789-87733811 ACACTCTCCAACTGTGCCTCTGG - Intergenic
1120875230 14:89369058-89369080 CCACTCTACCAATCTTCCTGGGG + Intronic
1121572973 14:94961601-94961623 ACACTCTCCCATTCCCCCTTAGG + Intergenic
1121956674 14:98219724-98219746 AGACCCTCCCAGGCTTCCTTTGG + Intergenic
1122115364 14:99524862-99524884 CCACCTGCCCAGTCTTCCTCGGG + Intronic
1122529344 14:102414964-102414986 ACACTCTTCTTGTCTGCCTCTGG - Intronic
1123111401 14:105868712-105868734 TCACTCTCCCAGTCCTCTTAGGG - Intergenic
1124110423 15:26780274-26780296 ACACTTTCCCTGTCTGTCTCTGG - Intronic
1125815547 15:42580983-42581005 TCCGTCTCCCACTCTTCCTCTGG - Intronic
1128207156 15:65862996-65863018 ACAGTCTCCCAGAATTCCTGTGG - Intronic
1130164287 15:81436806-81436828 AGGCTCTCCCAGTTTTCCCCAGG + Intergenic
1130803113 15:87287551-87287573 ACATTCTTACAGTCTTCCTTTGG - Intergenic
1131469647 15:92684905-92684927 AAGCTCTCCCACTCTACCTCTGG + Intronic
1132476461 16:141300-141322 ACCCTATCCCAGGCTTCCCCAGG + Intergenic
1133304346 16:4800374-4800396 ACACCCTCCCAGGCTTGCTGTGG + Intronic
1133518496 16:6532947-6532969 ACAGTCTCCCAGTGTCCCTGTGG + Intronic
1133812175 16:9169158-9169180 TCCCTCTCCCAGTCTGCTTCTGG + Intergenic
1136563568 16:31055965-31055987 ACCCTCTCCCAGAATTGCTCGGG - Intergenic
1138230388 16:55331925-55331947 ACACTCGCCCGCGCTTCCTCTGG + Intergenic
1138384499 16:56626858-56626880 TCACTCTCCCCTTCTTCCCCAGG + Exonic
1138386147 16:56636830-56636852 TCACTCTCCCCTTCTTCCCCAGG + Intergenic
1138388525 16:56652952-56652974 TCACTCTCCCCTTCTTCCCCAGG + Exonic
1138392149 16:56677630-56677652 TCACTCTCCCCTTCTTCCCCAGG + Exonic
1141985565 16:87577502-87577524 ACCCTCTCCCACTCATCCACTGG + Intergenic
1142182354 16:88677436-88677458 ACACTCTCCCACTCCTGCGCTGG + Intergenic
1142641996 17:1289611-1289633 ACCCTCTCCCACTCCTCCTCAGG + Intronic
1146306170 17:31731314-31731336 CCACTTTCCCAGGCTGCCTCTGG + Intergenic
1147725515 17:42564182-42564204 TCCCTCTGCCAGTCTCCCTCAGG - Intronic
1147880800 17:43652114-43652136 ACACTCAGCCAGTATCCCTCTGG - Intronic
1148582666 17:48754390-48754412 ATTCCCTCCCAGTCTTTCTCTGG + Intergenic
1148668846 17:49395109-49395131 ACATTCTCCTAGTCTTTCCCCGG + Intronic
1149229542 17:54517763-54517785 ACATTCTCCTAGTCTCCGTCAGG + Intergenic
1151908348 17:77064493-77064515 ATTCTCTGCCTGTCTTCCTCTGG + Intergenic
1156586599 18:38437922-38437944 ACAGCCTCCCAGGCATCCTCAGG + Intergenic
1156841392 18:41614132-41614154 TCACTCTCCCCCTCCTCCTCTGG + Intergenic
1157437863 18:47686513-47686535 CCACTCTCCCAATCTACATCGGG + Intergenic
1157501374 18:48193288-48193310 ACACTCTCCCTGACTTCCAGAGG + Intronic
1158275071 18:55758217-55758239 ACAGTCTCCACGTTTTCCTCTGG + Intergenic
1158597476 18:58828657-58828679 ACACTCTTCAAGTCTTCCCACGG + Intergenic
1158729011 18:60002609-60002631 CCATTCTCCCTGTCTTCTTCAGG + Intergenic
1160232314 18:77057805-77057827 AAACACTCCCCGCCTTCCTCAGG - Intronic
1160590929 18:79944264-79944286 ACACTATCCCCGCCTTCCCCAGG - Intronic
1162416621 19:10542192-10542214 AGAGTCTCCCAGTGTTGCTCAGG - Intergenic
1163835059 19:19568193-19568215 ACACTCTACCAGTATCCCTCAGG + Intronic
1163835079 19:19568309-19568331 ACACTCTATCAGTATCCCTCAGG + Intronic
1163835088 19:19568367-19568389 ACACTCTATCAGTATCCCTCAGG + Intronic
1164981056 19:32614924-32614946 ACCCTCTCCCAGCTTTCCCCAGG - Intronic
1166784808 19:45361316-45361338 ACATTTTCACAGACTTCCTCGGG - Intronic
926610434 2:14941317-14941339 ACACCCTCCCAGCATTGCTCTGG - Intergenic
927096184 2:19749433-19749455 CCACTGTCTCAGTCTTCCTGCGG + Intergenic
928280254 2:29939968-29939990 ACTGTCTCCCAGACTTCCCCAGG - Intergenic
930733711 2:54753615-54753637 AGAGTCTCCCAGTCTCCCTAGGG + Intronic
931078949 2:58747404-58747426 ACACTCTCCCAGGCCTCTTGTGG - Intergenic
931691186 2:64836259-64836281 ACTCCCTCCCATCCTTCCTCTGG - Intergenic
933892724 2:86786359-86786381 CCTCTCTCCCTGTCATCCTCCGG - Intronic
937288419 2:120767433-120767455 TCCCTCTCCCAGTCTGCCGCTGG + Intronic
937914192 2:127090820-127090842 ACACTCCCACAGTCTTCATTAGG + Intronic
938907151 2:135848297-135848319 ACACTCTCACAGTGTTGCTTTGG + Intronic
940274636 2:151926243-151926265 ACACTCTCTTGGTTTTCCTCTGG - Intronic
943129763 2:183840470-183840492 ATACTCTCCCCCTCTTCCTATGG - Intergenic
1170006907 20:11679253-11679275 AGATTCTCCAAGGCTTCCTCTGG + Intergenic
1172311843 20:33924450-33924472 ACAGTGTCCCAGTATCCCTCTGG - Intergenic
1174502367 20:50995100-50995122 AGACTCTCTCTCTCTTCCTCTGG - Intergenic
1175142107 20:56868498-56868520 ACACTCTCACAGTATTCTACTGG + Intergenic
1178615000 21:34124866-34124888 ACAGTCTCCCAGTTTTTCTTTGG + Intronic
1179115506 21:38488114-38488136 GCACTGTCCCAGACTTCCTGGGG + Intronic
1180646288 22:17341912-17341934 CCACCCTCCCAGTACTCCTCTGG - Intergenic
1183238540 22:36638530-36638552 ACTCTCCCCCAGTTTTTCTCTGG + Intronic
1183383414 22:37501863-37501885 ACACTTTCCCAGCCTGACTCAGG + Intronic
1183439974 22:37817665-37817687 ACTCTCTCCCTGCCTTACTCTGG + Intergenic
1184942081 22:47776408-47776430 AGACTCTTCCAGTCTTGCTGAGG + Intergenic
1185078015 22:48693706-48693728 ACTCTCTCTCAGTCCTGCTCCGG + Intronic
1185348493 22:50321114-50321136 TCCCACCCCCAGTCTTCCTCCGG - Intronic
950645676 3:14375206-14375228 ACAGTGTTCCAGCCTTCCTCTGG + Intergenic
950811158 3:15651182-15651204 ACGCTGTCCCAGTGTTCCCCTGG - Intergenic
952027440 3:29099942-29099964 TCACTCTCACAGTGTTCCACTGG + Intergenic
952073432 3:29667720-29667742 GCACTGACCCAGTCTTTCTCTGG + Intronic
953235021 3:41098702-41098724 AGAATCTCCCTGTCTTCCCCTGG - Intergenic
953460888 3:43080468-43080490 ACACTGTCACTGTCTTCATCTGG + Exonic
957121105 3:76094072-76094094 ACATTCCCCTATTCTTCCTCAGG - Intronic
958178290 3:90024328-90024350 ACCATCTCTCAGACTTCCTCAGG - Intergenic
959047276 3:101488462-101488484 ATTCTCTCCCATTCTTTCTCAGG - Intronic
959481081 3:106873312-106873334 AGACTGCCCCTGTCTTCCTCAGG - Intergenic
962818687 3:139025526-139025548 TCACTCTCCCAGTCTGTCTTTGG + Intronic
963461089 3:145616088-145616110 CCACTCTCCCCGTATCCCTCTGG + Intergenic
964406172 3:156351798-156351820 TCTCTCTCCCTGCCTTCCTCTGG + Intronic
968179049 3:196577076-196577098 ACACTCTCCCACTCCATCTCTGG + Intronic
968280456 3:197473057-197473079 ACACTGTCCCTGTGTTCTTCTGG + Intergenic
968585430 4:1414172-1414194 TCACTCTCCAAGGCTTCCGCAGG - Intergenic
970047053 4:11866294-11866316 TCACTCCACCAGTCTTCCTCAGG - Intergenic
970263088 4:14250284-14250306 ACTGTCTACCAGTCTTCTTCAGG - Intergenic
974768817 4:66384075-66384097 CCATTCTCCCAGTCTCCTTCTGG - Intergenic
976729441 4:88247048-88247070 GCAGTCTCCCAGTGTTGCTCAGG + Intergenic
976787662 4:88840107-88840129 ACAGTCTCCTGGTTTTCCTCTGG - Intronic
976833390 4:89341478-89341500 CCACTCTCCTTGCCTTCCTCAGG + Intergenic
978710664 4:111776767-111776789 AGACTCACACAGTCCTCCTCTGG - Intergenic
979165404 4:117523151-117523173 ACAGTCCCCCTCTCTTCCTCTGG - Intergenic
980957208 4:139441507-139441529 GTACTGTCCAAGTCTTCCTCTGG + Intergenic
981281227 4:142961837-142961859 TCACTCTCCAAGTCTTCTTTTGG + Intergenic
981461190 4:145014872-145014894 GCACTCTCCCCGTTTTCCTATGG - Intronic
982249102 4:153386470-153386492 ACAGTCTCCCACTGTTGCTCAGG - Intronic
982354472 4:154451179-154451201 ACAGTATCCCTGTCTGCCTCTGG - Intronic
982782576 4:159506647-159506669 ACACTTTCCAAGTCTTTCCCTGG - Intergenic
983689044 4:170445831-170445853 CCACACTGCCAGTCTCCCTCAGG - Intergenic
984185102 4:176534050-176534072 ACACTCTCTCAGTATTCTACTGG - Intergenic
984256218 4:177392933-177392955 CCACTCTCCCATTCTGCCTGTGG + Intergenic
986259894 5:6134914-6134936 CCTTTCTCCCACTCTTCCTCAGG - Intergenic
987332183 5:16866978-16867000 CCACTCACTCAGTCTCCCTCGGG + Intronic
987739472 5:21887516-21887538 CCAGTGTCCCATTCTTCCTCTGG + Intronic
989682457 5:44045684-44045706 CCACTCTCCCTGTCTCCTTCAGG + Intergenic
993277344 5:85877484-85877506 ACCCACTCCCACTCTTCCCCCGG + Intergenic
993654094 5:90557037-90557059 ACCCTCACCCAATCTACCTCAGG - Intronic
994597850 5:101861745-101861767 ACACTCTCCCTGTCTTTTTCAGG - Intergenic
995435137 5:112127434-112127456 ACATTACCCCAGTTTTCCTCTGG + Intergenic
997589104 5:135062186-135062208 TCACTCTCGCCTTCTTCCTCTGG - Intronic
998781898 5:145666425-145666447 CAACACTCCCAGTCTTCCTTTGG - Intronic
999480712 5:151945661-151945683 ACACAGTCCCTGCCTTCCTCGGG - Intergenic
999756585 5:154669114-154669136 ACTCTTCCCCAGTCTTCCCCAGG - Intergenic
999865129 5:155693126-155693148 CCACTCTCCTAATCTTGCTCTGG - Intergenic
1004085684 6:12446694-12446716 ACACTCTCCTTGTTTTTCTCTGG + Intergenic
1006894180 6:37456109-37456131 TCCTTCTCCCAGTCTTCCTTTGG + Intronic
1013758221 6:113485237-113485259 ATTCTATCCCAGTCTTCCTAAGG + Intergenic
1016862658 6:148736401-148736423 ACACTCTCCTGGTTTTCCTCTGG + Intergenic
1018913292 6:168116675-168116697 ACACTCTCCCAGGTTTCTCCTGG - Intergenic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1022803671 7:33800030-33800052 ACACTCTTCCAGTCTGATTCAGG + Intergenic
1023473540 7:40551847-40551869 TCACTCTGACTGTCTTCCTCAGG - Intronic
1024082379 7:45865960-45865982 TCACTCTCCTAATCTTCCACAGG + Intergenic
1024453658 7:49579054-49579076 AAACTCTGCCAGTTTTCCTAGGG + Intergenic
1025943359 7:66089145-66089167 ACACACGCCCAGCCTTGCTCCGG - Exonic
1028488757 7:91387866-91387888 ACACTTTCCCTGGCTTCATCTGG - Intergenic
1029200951 7:98838935-98838957 ACACACCCCCAGTCTCCCCCAGG + Intergenic
1031380583 7:121080813-121080835 TCACTCTTCCAGTCTCCTTCTGG + Intronic
1034717590 7:153257554-153257576 AGAGTCTTCCATTCTTCCTCTGG - Intergenic
1034886955 7:154805415-154805437 TCATGCTCCCTGTCTTCCTCAGG - Intronic
1035370053 7:158373991-158374013 ACACTCTGCCCGTTTCCCTCAGG - Intronic
1040105891 8:43541774-43541796 ACACCCTCCAAGCCTTCCCCAGG + Intergenic
1040569708 8:48596857-48596879 ATCATCTCCCACTCTTCCTCTGG - Intergenic
1043742005 8:83825831-83825853 ACATTTTCCCAGTCTCCTTCAGG + Intergenic
1048176521 8:132157526-132157548 ACACTCTCCCAGCCAGCCACTGG - Intronic
1048621107 8:136133784-136133806 AAACTCTGCCAGTCAGCCTCTGG + Intergenic
1048752892 8:137699782-137699804 CCTCCCTCCCAGTCTTGCTCTGG - Intergenic
1049967141 9:790136-790158 AAACTCTACCTGTCTTCATCCGG + Intergenic
1050982478 9:12037362-12037384 CCATTCTCCCTGTCTCCCTCTGG - Intergenic
1052031700 9:23636485-23636507 CTAGTCTCCCAGTCTTCTTCTGG + Intergenic
1052471635 9:28903891-28903913 ACACTGTCCCTGTCTTCCTTTGG - Intergenic
1052546806 9:29890146-29890168 CCATTCTCCCAGTCTCCTTCTGG - Intergenic
1057867954 9:98696313-98696335 GCACTCTCCCTCTCTTCTTCAGG - Intronic
1057950950 9:99368703-99368725 ACGCTCTCACAGAGTTCCTCTGG + Intergenic
1060294255 9:122332515-122332537 CCACTTTCCAAGTCCTCCTCAGG - Intergenic
1060547111 9:124468218-124468240 GCACTTTCCCAGGCTTCCCCGGG - Intronic
1185854456 X:3521114-3521136 CCACACTCCCAGTCTTTCCCAGG - Intergenic
1186987488 X:15032635-15032657 ACACTGTGCCAGCCTTCCTTGGG - Intergenic
1187622601 X:21074980-21075002 AGACTCTGGCATTCTTCCTCTGG + Intergenic
1187833847 X:23410598-23410620 CCCCTTTCCCTGTCTTCCTCTGG + Intergenic
1187935715 X:24334026-24334048 ACACTGTCCCACTTTTCCACTGG + Intergenic
1188086919 X:25910210-25910232 AGTCTCTCCTAGTCATCCTCTGG - Intergenic
1188471953 X:30550710-30550732 ACCCTCTGCCAGTCCTCCTGGGG - Intergenic
1190618413 X:52262107-52262129 ACACTCTCCCAGCCAGCCCCTGG + Intergenic
1191038656 X:56055672-56055694 ACACTCTCTCCATCTTTCTCAGG + Intergenic
1191178257 X:57529778-57529800 AGACTCTCCCAGTTTTCACCTGG + Intergenic
1194901636 X:99519665-99519687 ACCCTCTCCCTGTCATACTCTGG - Intergenic
1196088203 X:111709066-111709088 ACACTCTACCAGTTCTCCCCTGG - Intronic
1198935150 X:141896563-141896585 ACACTGTCACTGTCTTCCTCAGG + Intronic
1200820575 Y:7578598-7578620 ACATTCTCCCTGACTTGCTCCGG + Intergenic
1201907191 Y:19097607-19097629 ACACTCTCTCTGTCTCCTTCTGG - Intergenic
1202043737 Y:20714769-20714791 ACACTCTCCCACTTTTCCTATGG - Intergenic