ID: 919697380

View in Genome Browser
Species Human (GRCh38)
Location 1:200591715-200591737
Sequence CTGGCCCTGACCGGTTATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 51}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919697380_919697389 14 Left 919697380 1:200591715-200591737 CCCTGATAACCGGTCAGGGCCAG 0: 1
1: 0
2: 0
3: 2
4: 51
Right 919697389 1:200591752-200591774 GCTTCCACACCACACAGTTCGGG 0: 1
1: 0
2: 1
3: 8
4: 157
919697380_919697388 13 Left 919697380 1:200591715-200591737 CCCTGATAACCGGTCAGGGCCAG 0: 1
1: 0
2: 0
3: 2
4: 51
Right 919697388 1:200591751-200591773 AGCTTCCACACCACACAGTTCGG 0: 1
1: 0
2: 0
3: 10
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919697380 Original CRISPR CTGGCCCTGACCGGTTATCA GGG (reversed) Intronic
909489182 1:76207611-76207633 CTAGCCCACACCGGTGATCATGG + Intronic
909534502 1:76721192-76721214 CTGGCCATGACAGAGTATCAGGG + Intergenic
919697380 1:200591715-200591737 CTGGCCCTGACCGGTTATCAGGG - Intronic
922446723 1:225704141-225704163 CTGGCTCTGACCTCATATCAAGG + Intergenic
1086059869 11:82689610-82689632 CTGGGCAGGACCGGTTCTCAGGG + Intergenic
1087707653 11:101513116-101513138 GTGGCCCTGACCTTTTATGAAGG + Intronic
1088050163 11:105503540-105503562 CTGGCCTTGACCTTTTATAATGG + Intergenic
1097925539 12:65122134-65122156 CGGGCACTGCCGGGTTATCAGGG - Intergenic
1102876608 12:116454080-116454102 GTGGCCCTGACAGGTAAACATGG - Intergenic
1105700152 13:22929702-22929724 ATGGCTCTGGCCCGTTATCATGG - Intergenic
1110561535 13:76915285-76915307 CTGCCCCTGACTGGTAATCAGGG + Intergenic
1119430908 14:74567476-74567498 GTGGCCCTGAGAGGTTCTCAGGG + Intronic
1122841659 14:104467662-104467684 ATGGCTCTGGCCCGTTATCATGG - Intergenic
1128843343 15:70868414-70868436 TTGGCCCTGACCATTTATAAGGG - Intronic
1132658235 16:1050112-1050134 CTGGCCGTCACCGGGAATCATGG - Intergenic
1132909136 16:2299392-2299414 CTGGCCCTCACCTGTGAGCATGG + Exonic
1134093369 16:11403245-11403267 CTGGCACTGGCTGGTTCTCAGGG + Intronic
1143537621 17:7550550-7550572 CTGGCCCCCACCTGTTATCTCGG + Intronic
1143636206 17:8164958-8164980 CTGGCCTTGACCGTGTATCTGGG - Intergenic
1146509448 17:33433463-33433485 CTGTGCCTGGCCGGTCATCAAGG - Intronic
1149784704 17:59425169-59425191 CTGGGCCTGACCTGCTGTCAGGG + Intergenic
1150250186 17:63700527-63700549 CAGGCCCCGCCCGGTTATCCCGG - Intronic
1152865168 17:82718026-82718048 CTGGCCCTGACCTGTTCTGCGGG + Intronic
1160305524 18:77731717-77731739 CTTGCCCTGTCGGGTTTTCAGGG - Intergenic
1162097900 19:8321668-8321690 CTGGGCAGGACCGGTTCTCAGGG + Exonic
929093077 2:38239158-38239180 CTGGCTCTGCCAGGTGATCATGG - Intergenic
936010015 2:108919652-108919674 CTGGCCCTGACTGCTTTTCTAGG + Intronic
1170940459 20:20844352-20844374 CAGGCTCTGAGGGGTTATCAGGG - Intergenic
1174379237 20:50146118-50146140 CTGGCCCTGACCCCTTCACAGGG - Intronic
1182420876 22:30248022-30248044 CTGACCCTGACCTGAGATCAAGG + Intergenic
1184422492 22:44390153-44390175 CTGGCCCTGGCAGGTGCTCAGGG - Intergenic
1184437952 22:44490937-44490959 CAGGCCCTCACCTGTTACCAGGG + Intergenic
950416834 3:12873637-12873659 CTGTTCCTGTCCGGATATCATGG - Intergenic
971363451 4:25957335-25957357 CTGGCCCTGGGAGGTAATCACGG + Intergenic
974343021 4:60638389-60638411 CTGGCCCTGAACAGTTCCCAAGG - Intergenic
974487086 4:62519362-62519384 CTGGCCATTACAGGATATCATGG + Intergenic
978923735 4:114217490-114217512 CCTGCCCTGAGCAGTTATCACGG + Intergenic
979721679 4:123906877-123906899 CTGGCCCTGAGGGGATATTAGGG + Intergenic
984346967 4:178540992-178541014 CTGCGCCTGGCCTGTTATCAAGG - Intergenic
1002440364 5:179261460-179261482 CTGGCCCTGAGCAGCCATCAGGG - Intronic
1015707404 6:136103185-136103207 CTGGGCCTGCCTGGTCATCAAGG - Intronic
1025142289 7:56476209-56476231 CTGTCCCTGACCTGAGATCATGG + Intergenic
1035022563 7:155808117-155808139 CAGGCACTGACCTGTTACCAGGG - Intronic
1036767914 8:11560621-11560643 CTGGCCCAGGCTGGTGATCAGGG + Intronic
1041194398 8:55386342-55386364 CTGGCCCTGATCTTTTATCGTGG + Intronic
1045482411 8:102602565-102602587 CTGGCCCAGATGGGATATCAAGG - Intergenic
1047319960 8:123769435-123769457 CTGGCCCTGACCACTTTTCCAGG - Intronic
1049673910 8:143881278-143881300 CTGGCCCTGACCGAGCAGCATGG - Intergenic
1057388841 9:94626509-94626531 CTGGTCCTGACTGCTCATCATGG - Intronic
1058101208 9:100919495-100919517 CTGCCCCTGACAGGTGAGCATGG + Intergenic
1061450912 9:130666571-130666593 CGGGCTCTGACCGGTTTTCCTGG + Intronic
1062071644 9:134558503-134558525 CTGTCCCTGCCAGGTGATCAAGG + Intergenic
1188393608 X:29652781-29652803 CTGGCCCTGATCAGTTATCTTGG + Intronic
1189609441 X:42716030-42716052 CTGGCCCTGACAGATCACCAGGG + Intergenic