ID: 919699590

View in Genome Browser
Species Human (GRCh38)
Location 1:200618164-200618186
Sequence ACCTGTGGATCTTCATCTAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919699589_919699590 -9 Left 919699589 1:200618150-200618172 CCATCATTTCAATGACCTGTGGA 0: 1
1: 0
2: 0
3: 12
4: 154
Right 919699590 1:200618164-200618186 ACCTGTGGATCTTCATCTAAAGG 0: 1
1: 0
2: 0
3: 7
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919699590 Original CRISPR ACCTGTGGATCTTCATCTAA AGG Exonic
902133795 1:14286708-14286730 ACCTGGGGATGTTAATCTAGGGG - Intergenic
902390243 1:16099646-16099668 TCCTGTGTATCTTCTTCTAAGGG - Intergenic
907555637 1:55341767-55341789 ACCTGTGGTTCTCAATCTGAAGG + Intergenic
909198750 1:72661380-72661402 AGTTGTGGTTCTTCCTCTAAGGG + Intergenic
909484873 1:76161505-76161527 TGCTGTGGGTCTTCATTTAATGG + Intronic
911375575 1:97046870-97046892 ACCTGTTGATCCTCATCAACTGG + Intergenic
913683450 1:121208890-121208912 AACTGTAGACCTTCATATAAGGG + Intronic
914035291 1:143996514-143996536 AACTGTAGACCTTCATATAAGGG + Intergenic
914154162 1:145071456-145071478 AACTGTAGACCTTCATATAAGGG - Intronic
917806804 1:178621072-178621094 ACCTGTGGTTCTTCATCACTTGG - Intergenic
919699590 1:200618164-200618186 ACCTGTGGATCTTCATCTAAAGG + Exonic
920470758 1:206227399-206227421 AACTGTAGACCTTCATATAAGGG + Intronic
921304282 1:213780393-213780415 GCCTAAGGATCTTCATCTATAGG + Intergenic
921829333 1:219709993-219710015 AGCTCTGGGGCTTCATCTAAAGG + Intronic
921993388 1:221391541-221391563 ATCTTTGGGTCTTCATCTAAAGG - Intergenic
1063426979 10:5958036-5958058 ACCTATGGATTTTCAATTAATGG + Intronic
1064647085 10:17470829-17470851 ATCTTTGGGTCTTCACCTAAAGG + Intergenic
1066570804 10:36769784-36769806 ACCTGTGCTTCTTCCTCTATAGG - Intergenic
1066588820 10:36969636-36969658 ATCTGTGGATCTTCAGTTGATGG - Intergenic
1068403916 10:56565537-56565559 ACTTCTGGATATTCATTTAAAGG + Intergenic
1070641382 10:78172901-78172923 ACCTGTGGATATTTGTCTAAGGG + Intergenic
1073498246 10:103913348-103913370 CCCTGTGAATTTTCATCTCACGG + Intronic
1073937534 10:108651617-108651639 CCCTGTAAATCTTCATCTATTGG + Intergenic
1075856462 10:125634105-125634127 ACCTTTGTATATTCATTTAAGGG + Intronic
1076058175 10:127392385-127392407 ACCTCTGGATCTCCCTCTGAGGG + Intronic
1077266056 11:1650846-1650868 AGCTGTGGACCTGCAGCTAAAGG - Intergenic
1077605843 11:3611375-3611397 ACCTGTGGGTCTAGACCTAAGGG + Intergenic
1077914117 11:6600124-6600146 ACCTCTGGATCTTCCTTGAAAGG - Exonic
1079406368 11:20150275-20150297 ACCAATGGATCTTCATGTAAAGG + Intergenic
1082612676 11:55320735-55320757 TCTTGTGGTCCTTCATCTAAAGG - Intergenic
1085530621 11:77190021-77190043 ACCTGCGGAACTTCATCCACGGG + Exonic
1086188234 11:84045811-84045833 AACTGGGGGTCTTAATCTAAAGG + Intronic
1086590186 11:88506435-88506457 CCCTTTGGATCCTCATCAAAAGG - Intronic
1087063949 11:94010130-94010152 ATCTGTGGATCTTGATCTTGGGG - Intergenic
1088952964 11:114589198-114589220 ACCTGTTGACCTTCATCTCTGGG - Intronic
1088961999 11:114677992-114678014 ACCTGTGGCTGTTCCTCTTATGG + Intergenic
1090899148 11:131010666-131010688 ACATGTGGCTTTTCTTCTAAAGG - Intergenic
1091601642 12:1921460-1921482 AACTGTGGCTTTTCCTCTAAGGG - Intergenic
1092240988 12:6836574-6836596 AACTGTGGAACTTCCTCTTAGGG + Intronic
1093323935 12:17749529-17749551 ACCTGTGAATCTTCCTCTTTTGG + Intergenic
1096210060 12:49758344-49758366 ACCTGTAGCCCTTAATCTAATGG + Intronic
1105555697 13:21446597-21446619 ACCTATGGATCTCTATTTAAGGG + Intronic
1107272253 13:38633905-38633927 AGTTGTGGAACTTCATCTAGTGG - Intergenic
1108280918 13:48860754-48860776 ACCTGGGGATGTCCTTCTAATGG - Intergenic
1110052288 13:70919342-70919364 ATCTGTGGACCTTAATCTAGAGG + Intergenic
1110097879 13:71553767-71553789 ACCTCTGGTCCTTCAACTAATGG + Intronic
1113604996 13:111598707-111598729 ACCTGTGGATTTTTGCCTAAGGG + Intronic
1117208993 14:53476063-53476085 CTCTGAGGATGTTCATCTAATGG - Intergenic
1119917871 14:78419042-78419064 AACTGAGGCTCTTCATGTAAAGG - Intronic
1124103981 15:26720444-26720466 ACCTTTGAATCTTCATCACATGG - Intronic
1127655969 15:61056294-61056316 ACCTCAGCTTCTTCATCTAATGG - Intronic
1130963037 15:88677214-88677236 ACTGGTGGATCATCAGCTAAAGG - Intergenic
1135474258 16:22760461-22760483 AGCTGTGGTTCTTAATCTAGGGG - Intergenic
1142546141 17:704547-704569 TCCTGTGGATCTTAATGAAAAGG - Intronic
1144103310 17:11963133-11963155 ACCTGTGTGTCTTCTTATAAGGG - Intronic
1144176362 17:12711757-12711779 TCCAGTGGATCTTGATCTAGGGG - Intronic
1150688122 17:67337035-67337057 ACAAGTGGTTCTTCATCTCAAGG - Intergenic
1151547665 17:74803044-74803066 ACCTTTGGATTTTCATATAATGG - Intronic
1151794053 17:76330628-76330650 CACTATGGATCTTCATCAAAAGG - Exonic
1152407983 17:80108314-80108336 ACCTGTCGACCTCCAGCTAAGGG - Intergenic
1155762104 18:29581373-29581395 ATCTGTGTATCTTCATATGAAGG - Intergenic
1158438179 18:57449256-57449278 TCTTCTGGATCTTAATCTAATGG - Intronic
1164808199 19:31134033-31134055 ACATTTGCACCTTCATCTAATGG - Intergenic
1164879850 19:31723176-31723198 ACCAGTGGATTTTAATGTAATGG - Intergenic
1166851373 19:45763102-45763124 ACATCTGGATCTTCCTGTAAAGG - Intronic
1167003977 19:46763399-46763421 ACCTGTTGATTTACATCTGATGG - Intronic
930759745 2:55021244-55021266 ACCTGTGTATCTTCGTGAAAGGG - Intronic
936586048 2:113758666-113758688 AGCTGTGGATATTCTTGTAACGG + Intergenic
941056266 2:160792378-160792400 ACTTCTGGATATACATCTAAAGG + Intergenic
947241267 2:227996929-227996951 GCTTCTGGATCTTCATCTACAGG - Intronic
949081212 2:242101339-242101361 GCATGTGTGTCTTCATCTAAAGG + Intergenic
1169617663 20:7468233-7468255 CCAAGTGGAACTTCATCTAATGG - Intergenic
1170509582 20:17063104-17063126 ACCTCTGGCTCTTCTTCTCAAGG - Intergenic
1170571213 20:17633930-17633952 GCGGGTGGATCTTCATCTCAAGG - Intronic
1175019629 20:55830629-55830651 ACCTGTGTAACTTCAGCTAGAGG + Intergenic
1180657735 22:17437345-17437367 TCCTGTGGAGCTTCAACAAAGGG - Intronic
1183738264 22:39655802-39655824 ACCTGTTAATCTTTTTCTAATGG - Intronic
949151066 3:767474-767496 TCTGCTGGATCTTCATCTAATGG + Intergenic
952984091 3:38762343-38762365 ACCTCTGGAACTTCAGTTAAGGG - Intronic
963464432 3:145660901-145660923 TCCTGGGGATCTTCATCCACCGG + Intergenic
964831047 3:160885002-160885024 ACCTGTGGAGCTTTTTCAAAAGG + Intronic
966101366 3:176272754-176272776 ACCTGTGGAGTTTCAAATAAGGG - Intergenic
966759235 3:183401879-183401901 TGCTGTGAATCTTCATGTAAAGG + Intronic
967998390 3:195184135-195184157 ACCTGTGTATCTTGCTCTGATGG - Intronic
974544942 4:63290897-63290919 CCCAGTGGATCATCCTCTAAAGG - Intergenic
983772398 4:171568463-171568485 ACATGTGGATATGCATCTGAGGG - Intergenic
986453632 5:7892440-7892462 CCCTAAGGATCTTCATGTAAAGG - Intronic
987664647 5:20921691-20921713 ACCTGTGGTTCTGAACCTAAAGG + Intergenic
988758037 5:34280491-34280513 ACCTGTGGTTCTGAACCTAAAGG - Intergenic
995713425 5:115057662-115057684 ACCTGTGGATACTCATGGAATGG + Intergenic
996129935 5:119769757-119769779 GCCAGTGGATCTTCACTTAATGG - Intergenic
996424909 5:123304036-123304058 AGCTATGGATATTCATCAAAGGG + Intergenic
998295379 5:140965107-140965129 ATCTGTAGATCTTCCTCTATGGG - Intronic
998770848 5:145543429-145543451 AGTTGTGGCTCTTTATCTAATGG + Intronic
1001180124 5:169512637-169512659 AGCTGTGGATCTGCCTCCAAGGG + Intergenic
1001739798 5:174043286-174043308 ACTACTGGATGTTCATCTAAAGG - Intergenic
1009489682 6:64274092-64274114 ACCTGTGGACCGTCACTTAAAGG - Intronic
1010822948 6:80436730-80436752 AACTGTAGATCTTCTTCAAAAGG - Intergenic
1018940653 6:168307470-168307492 ACCTGCGGATCTTCTTCTTCAGG + Exonic
1019566328 7:1681039-1681061 GCCTGTGGATTTACATTTAATGG + Intergenic
1020711287 7:11608743-11608765 GGTTGTGGATGTTCATCTAAGGG - Intronic
1021103461 7:16609956-16609978 ACCTTTGCATATTCATTTAATGG - Intronic
1027009058 7:74726023-74726045 ACCTGTGGAGCTCCATCCCATGG - Intronic
1027837772 7:83267315-83267337 AGCTTTGGATCTTCAGCTGAAGG + Intergenic
1037537664 8:19840828-19840850 AGCTGTGAGTCTTCATCTACAGG - Intronic
1039793467 8:40893378-40893400 ACCTCTGGCTCTATATCTAAGGG + Intronic
1041898038 8:62948810-62948832 ACCTCTCTTTCTTCATCTAACGG + Intronic
1042020115 8:64363879-64363901 AACTGTGGTTCTGCTTCTAAGGG + Intergenic
1042843264 8:73146168-73146190 AACTGTGGCTGTTCATCAAATGG - Intergenic
1043258436 8:78164954-78164976 ACCTGTGTTTTTTTATCTAATGG - Intergenic
1044198167 8:89403015-89403037 ACCTGTTGAGCTCCAGCTAACGG - Intergenic
1047256309 8:123216038-123216060 TCCTGTGGATCTCCACCCAAAGG - Intergenic
1049499550 8:142954479-142954501 AGTTGTGGATATTCATCAAATGG - Intergenic
1051794345 9:20848139-20848161 ATCTCTGGATCTTCATCTGAAGG - Intronic
1057822244 9:98341711-98341733 ACCTGTGGATCTTTATCTCGGGG + Intronic
1058952162 9:109914071-109914093 ACCTGTGGATTTTTATTGAAGGG - Intronic
1061181179 9:129026170-129026192 CCCTCTGGATCCTCATCTCAGGG + Intronic
1186752999 X:12641125-12641147 ACATATGGATCTTCATTTCAGGG - Intronic
1187580562 X:20603189-20603211 ACATGTGAATCTTCAACTCAGGG - Intergenic
1188870347 X:35364336-35364358 ACCTGTGGATCTTTCTCCCACGG - Intergenic
1192186315 X:68949078-68949100 ACCTGTGGTTCTTGATGTCAGGG - Intergenic
1192257999 X:69481942-69481964 ACCTGTCAATCTTCCTCTTATGG + Intergenic
1193283426 X:79683496-79683518 ACCTGAGGTTCTTGATCTCATGG - Intergenic
1196303401 X:114071929-114071951 ACCTGGAGATCTTTGTCTAATGG - Intergenic
1198445830 X:136713159-136713181 ATCTGTGGAAATTCTTCTAAAGG + Intronic
1199274012 X:145921430-145921452 TCTTGTGAATCTTCAGCTAAAGG - Intergenic