ID: 919699927

View in Genome Browser
Species Human (GRCh38)
Location 1:200621021-200621043
Sequence CATGACAGTGACACTCTTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 153}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919699925_919699927 7 Left 919699925 1:200620991-200621013 CCCTCGTTGAAGTGGGTGTCAAA 0: 1
1: 0
2: 2
3: 2
4: 64
Right 919699927 1:200621021-200621043 CATGACAGTGACACTCTTGTCGG 0: 1
1: 0
2: 1
3: 11
4: 153
919699924_919699927 8 Left 919699924 1:200620990-200621012 CCCCTCGTTGAAGTGGGTGTCAA 0: 1
1: 1
2: 1
3: 6
4: 59
Right 919699927 1:200621021-200621043 CATGACAGTGACACTCTTGTCGG 0: 1
1: 0
2: 1
3: 11
4: 153
919699926_919699927 6 Left 919699926 1:200620992-200621014 CCTCGTTGAAGTGGGTGTCAAAC 0: 1
1: 0
2: 1
3: 7
4: 111
Right 919699927 1:200621021-200621043 CATGACAGTGACACTCTTGTCGG 0: 1
1: 0
2: 1
3: 11
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919699927 Original CRISPR CATGACAGTGACACTCTTGT CGG Intergenic
902206467 1:14871828-14871850 CATGACACTGAGACTCACGTGGG - Intronic
904562606 1:31408856-31408878 CATAACAGTAACACTCTGGAAGG - Intergenic
906347654 1:45029302-45029324 CATGACCTTGACACTTTTGCAGG + Intronic
911862809 1:102975610-102975632 CATTACAGTGACTCCATTGTTGG + Intronic
912173105 1:107124549-107124571 TATGTCAGAAACACTCTTGTAGG + Intergenic
913026004 1:114841118-114841140 CATGACAGCAACACTCATATAGG - Intergenic
913229422 1:116729550-116729572 CATGAAGATGACAATCTTGTTGG + Intergenic
913414580 1:118590722-118590744 CATAACAGTGACAATTGTGTGGG - Intergenic
915937184 1:160096439-160096461 CCTAAAAGTGACACTCTGGTTGG - Intronic
916455522 1:164967642-164967664 CATGACTTTGACATTCTTGAAGG + Intergenic
917511048 1:175669616-175669638 GTTGACATTAACACTCTTGTAGG - Intronic
917887272 1:179398825-179398847 CATTACAGTGACAGCCTTGGTGG - Intronic
919699927 1:200621021-200621043 CATGACAGTGACACTCTTGTCGG + Intergenic
919988685 1:202693669-202693691 CATGACTGTGACCCTCCTGTGGG + Intronic
921687234 1:218104033-218104055 CATGAAACTTACACTCTAGTTGG + Intergenic
921691674 1:218158078-218158100 GATGAAACTGACACTCCTGTAGG + Intergenic
923025256 1:230198524-230198546 CAGGAGAGTGAGACCCTTGTGGG + Intronic
923569242 1:235099490-235099512 CATTACTGAGACAGTCTTGTGGG - Intergenic
1066421127 10:35265837-35265859 CATGCCAGTGACACGCTGGTGGG - Intronic
1073570171 10:104574507-104574529 AATTACAGTGAAACTCTTGCTGG + Intergenic
1080230690 11:30015963-30015985 CCTGACAGTGACACAGTTGCAGG - Intronic
1080781172 11:35431300-35431322 CTTGGCAGTGACCCTCTTTTTGG - Intergenic
1083591351 11:63897142-63897164 CATGGAAGTGACATTCTTCTGGG - Intronic
1084497388 11:69513026-69513048 CAAGACATTGACCCGCTTGTGGG + Intergenic
1084672611 11:70616137-70616159 CATGAGATTGCCATTCTTGTAGG + Intronic
1086320363 11:85640561-85640583 CATGATAAAGATACTCTTGTGGG + Intergenic
1088018635 11:105091450-105091472 TATGACAGTGACACTGCAGTGGG - Intronic
1091181665 11:133610101-133610123 CATGAAAGTCTCACTGTTGTAGG - Intergenic
1094325336 12:29231862-29231884 TATGACAGTGAGATTCTTGATGG - Intronic
1095084808 12:38049826-38049848 CAGGGCAGTGACACTATTATGGG + Intergenic
1096856982 12:54490472-54490494 TAAGACAGTTTCACTCTTGTTGG + Intergenic
1099574254 12:84361600-84361622 GATGGCAGTTACACTCTAGTCGG - Intergenic
1101941036 12:109098950-109098972 CCTGACAGTGCCACTCCTCTCGG - Intronic
1102230220 12:111257145-111257167 CCTGACAGTGACCTTCTTGAGGG + Intronic
1106414759 13:29537247-29537269 AATAACAGTGACAGTCATGTTGG + Intronic
1106435464 13:29719924-29719946 AATGACTGTCACACTCTGGTGGG + Intergenic
1108221683 13:48240541-48240563 CATGTCAGTAACAATATTGTTGG + Intronic
1108755286 13:53493869-53493891 CATAACAGTTACTCTCCTGTAGG + Intergenic
1108826702 13:54421208-54421230 CCTAACACTGACACTCTTGCTGG - Intergenic
1109292348 13:60491950-60491972 CATGACTGTGAAACTCAAGTGGG - Intronic
1111169997 13:84514003-84514025 TATGACAGTGTTATTCTTGTGGG + Intergenic
1114222622 14:20710483-20710505 AATGGAAATGACACTCTTGTTGG - Intergenic
1114247351 14:20927225-20927247 CTTGAGACTGACAGTCTTGTGGG - Intergenic
1114695607 14:24624433-24624455 CATGACCTTGAAAATCTTGTTGG + Intergenic
1115522883 14:34251002-34251024 CAGGCCACTGAGACTCTTGTGGG + Intronic
1116341460 14:43728517-43728539 CATTACAGGGAGAATCTTGTTGG + Intergenic
1116800377 14:49437444-49437466 TATGACAGTGACAATCTTCCTGG + Intergenic
1120198383 14:81512370-81512392 CATATCATTGACATTCTTGTAGG + Intronic
1120570772 14:86114237-86114259 GATGACAGTGCCACTATAGTGGG - Intergenic
1120888515 14:89471076-89471098 CATGAAAGTGGCCCTCTAGTTGG + Intronic
1124564126 15:30799333-30799355 CCACAGAGTGACACTCTTGTCGG + Intergenic
1128285541 15:66433775-66433797 CATGTCAGTGACAATTGTGTGGG - Intronic
1130543968 15:84841134-84841156 CCTGACTGTGACCCTCTTCTGGG + Intronic
1135057426 16:19242189-19242211 CATGACCTTGACATTCTAGTTGG + Intronic
1140063539 16:71591183-71591205 CATGAAGCTGACATTCTTGTTGG + Intergenic
1140240436 16:73195038-73195060 CCTGAAAATGAAACTCTTGTGGG - Intergenic
1142367889 16:89659788-89659810 CTTCACACTGACACGCTTGTAGG + Intronic
1143281159 17:5755354-5755376 CATGACCTTGACACTTTTGAAGG + Intergenic
1147616754 17:41833762-41833784 CATGATATTGACACTTTTGACGG - Intronic
1148474653 17:47920080-47920102 CATGACCTTGACACTTTTGAAGG + Intronic
1150477385 17:65485443-65485465 CATGATAATGCCAGTCTTGTAGG - Intergenic
1151229036 17:72668872-72668894 CATGACACTGACATTTTTGAAGG - Intronic
1156488160 18:37479660-37479682 CATGACTCAGACACTATTGTAGG + Intronic
1159288986 18:66391720-66391742 CAGGACAGTTACAATCATGTTGG - Intergenic
1159341407 18:67138249-67138271 GATGAAAATGAGACTCTTGTGGG - Intergenic
1160106849 18:75986534-75986556 CCTGACAGAGTCACTCCTGTGGG - Intergenic
1160590404 18:79941359-79941381 CATGGCAGAGAGACTCTTGAGGG - Intronic
1160682543 19:418329-418351 CATGACCGTGACACTGCGGTCGG - Intronic
1163413759 19:17172983-17173005 CTCGACAGTGACGCTTTTGTGGG - Intronic
927659182 2:24978125-24978147 GGTGAAAGTGACACTCATGTGGG - Intergenic
927779148 2:25925546-25925568 CGAGACAGTTTCACTCTTGTTGG + Intergenic
928354024 2:30591999-30592021 CATGACATTAACAGTCTGGTAGG - Intronic
929992409 2:46801256-46801278 CATGGAACTGACACTTTTGTGGG - Intergenic
932634932 2:73379735-73379757 CATGACACTTACATTCTAGTGGG + Intergenic
932696512 2:73961394-73961416 CAACACAGTGAGACTGTTGTGGG - Intergenic
936282500 2:111154478-111154500 TATGACAGTGACATTTTTGAAGG + Intronic
936583690 2:113731159-113731181 TATGACCTTGACACTTTTGTAGG - Intronic
936846290 2:116838812-116838834 CATGAAAGATACATTCTTGTGGG + Intergenic
936872826 2:117153815-117153837 CATGATAGTGACACTTTTCTAGG - Intergenic
937580081 2:123474627-123474649 CATGACTGTGACATTCATGTGGG + Intergenic
938028426 2:127970861-127970883 CATGTCAGTGACTTTGTTGTGGG - Intronic
939554603 2:143659473-143659495 CATGAAAGACACACTCTTCTTGG - Intronic
944731267 2:202520217-202520239 GATGAAATTGACACTCATGTGGG + Intronic
944738310 2:202588528-202588550 CATTACAGTCACACCCTTGAAGG - Intergenic
946520296 2:220457206-220457228 GATGACAGTAACTTTCTTGTAGG + Intergenic
948160719 2:235821852-235821874 CATGACCTTGACACTATTTTAGG + Intronic
948726384 2:239936547-239936569 CAGGACAGGGACACTCTGGTGGG + Intronic
1170942060 20:20856291-20856313 CATGGCATTGACCCTCTTGGAGG + Intergenic
1170952914 20:20952960-20952982 CCTGACAGAGTCACCCTTGTGGG + Intergenic
1172353545 20:34262559-34262581 TCTGCCTGTGACACTCTTGTGGG - Intronic
1172588127 20:36099212-36099234 CATGACCATGACACTACTGTAGG - Intronic
1172914324 20:38432509-38432531 CATCACAATGACAATCCTGTGGG + Intergenic
1173124002 20:40320164-40320186 CAGGACAGTGAGACCCTTGCAGG + Intergenic
1173264345 20:41465467-41465489 CATGACCTTGACACTTTTGAAGG - Intronic
1176685295 21:9842913-9842935 TAGGACAGAGACAGTCTTGTGGG - Intergenic
1177818408 21:26003426-26003448 CAAGGCAGTGAAACTCTTGGGGG - Intronic
1184203667 22:42986574-42986596 CATGACAGTGACACTCTAATGGG + Intronic
949477677 3:4464448-4464470 CATGGCATTTACACTCTGGTAGG - Intronic
951403728 3:22268191-22268213 CATCAGAGTGACACTTATGTTGG - Intronic
951952816 3:28219845-28219867 AAAGACAATGACACTCTTGGAGG + Intergenic
955886622 3:63606066-63606088 AATAACAGTAACCCTCTTGTAGG - Intronic
957844563 3:85715240-85715262 CATGACAATGAGACCTTTGTTGG + Intronic
960738210 3:120803760-120803782 CATGATAGTGACTCTCTTAGGGG - Intergenic
965148673 3:164941832-164941854 CATGACAGTTTCACCCTCGTGGG + Intergenic
965674123 3:171176782-171176804 CATGACAGAGACTCTCTGCTGGG + Intronic
969726558 4:8921591-8921613 TAACACAGTGAGACTCTTGTTGG - Intergenic
970266506 4:14293883-14293905 CAGGCCAGTGTCGCTCTTGTGGG - Intergenic
970468747 4:16354208-16354230 AATGACATTGACATTTTTGTAGG + Intergenic
971877127 4:32321707-32321729 CATTAAAGTGACTCTCATGTTGG + Intergenic
972075391 4:35080000-35080022 CAGGGCTGTGACACCCTTGTTGG + Intergenic
972690549 4:41393368-41393390 CGTGACAGTGACATTCATGAAGG - Intronic
974540502 4:63227092-63227114 CTTCACAGTGAGAATCTTGTGGG + Intergenic
977666005 4:99648415-99648437 CATGAAAATAACAGTCTTGTGGG + Intronic
977706797 4:100080513-100080535 CATGAGAGTTCCACCCTTGTGGG - Intergenic
979556369 4:122052036-122052058 CTTGACAGTGAAATTCTTGAGGG + Intergenic
980348746 4:131661381-131661403 TAGGACAGGGACAGTCTTGTGGG - Intergenic
981257716 4:142682576-142682598 CATGAAAGTGACACTGTTTTAGG - Intronic
981783766 4:148454970-148454992 CATTCCAATGACACTCTTTTTGG + Intergenic
981889117 4:149715465-149715487 CAGGACTGTGACACTCTCTTTGG - Intergenic
983778024 4:171632924-171632946 CATGACCTTGACAATCTTGAGGG + Intergenic
985723227 5:1501573-1501595 CATGACACTGACGCTCTTCCCGG - Exonic
985855111 5:2418261-2418283 CTTGCCAGTGGCACTCCTGTTGG + Intergenic
986693999 5:10336038-10336060 AATGACATTGACATTTTTGTAGG - Intergenic
988066132 5:26230120-26230142 CATGTCTGTGAAAATCTTGTTGG + Intergenic
997375069 5:133391920-133391942 CATGGCAGGTACAGTCTTGTGGG - Intronic
999661846 5:153872610-153872632 CGTGGCAGAGACACTTTTGTTGG - Intergenic
999862424 5:155662898-155662920 CATGAAAGTGACATTCTAATAGG + Intergenic
1003639767 6:7866889-7866911 TAAGACAGTTTCACTCTTGTTGG + Intronic
1003830432 6:10004067-10004089 CATGAAATTGACATTTTTGTAGG + Intronic
1004077885 6:12361949-12361971 AATGAAAGTGACACTCTAGTGGG + Intergenic
1009241635 6:61192917-61192939 CAGGACTGTGACACTCTCTTTGG - Intergenic
1011510097 6:88090831-88090853 CCTGCCAGTGACACTAGTGTGGG - Intergenic
1012912363 6:105132547-105132569 CTTGAGAAAGACACTCTTGTGGG - Intronic
1013421616 6:109972424-109972446 CATGAGACTGACAATCTTGTGGG - Intergenic
1013620026 6:111878959-111878981 CCTCACAGTGTCACTCTTGAGGG - Intergenic
1017192282 6:151667283-151667305 CATGACATTGACTGTCTAGTGGG - Intronic
1018220579 6:161574163-161574185 CATCACAGGGACACTAGTGTGGG + Intronic
1018339150 6:162831098-162831120 CATGAAAGTTGCACTCTTCTGGG - Intronic
1019060715 6:169255516-169255538 CATGACACATACACTCTTGGAGG - Intergenic
1021481180 7:21119210-21119232 AATGACAGAGACCATCTTGTAGG - Intergenic
1022391979 7:29951098-29951120 CAGGACTGTGACACTCTCTTTGG + Intronic
1022834615 7:34101870-34101892 AATGACAGTGCCACACATGTGGG - Intronic
1023182759 7:37501895-37501917 CATGACATGAACACTCTTGTAGG + Intergenic
1027351703 7:77318261-77318283 CATGAAAGTGCCATTTTTGTTGG + Intronic
1031901367 7:127415022-127415044 CATGAAAGTGACAGTCCTTTGGG - Intronic
1038711421 8:29950491-29950513 AATGATTGTGACACTCTTGATGG + Intergenic
1041462839 8:58130943-58130965 GAAGACAGTGATACTGTTGTGGG - Intronic
1042576572 8:70227158-70227180 CCTGACAGAGACACTCGAGTGGG - Intronic
1046591700 8:116214901-116214923 CATGACAATGACACTGTTCCTGG - Intergenic
1049071801 8:140361261-140361283 CGTGCCATTGACACTCTTGTGGG + Intronic
1049864678 8:144926814-144926836 CATGAGGGTGTCACTCTTCTGGG - Intergenic
1051583183 9:18699225-18699247 CATGACAATGACGCTCTTTTGGG - Intronic
1052487578 9:29121700-29121722 CATGACAGTGTGGCTCATGTGGG - Intergenic
1052995089 9:34547688-34547710 CCTGACAGTGCCACTCTGATGGG - Intergenic
1054171975 9:61848835-61848857 TAGGACAGGGACAGTCTTGTGGG + Intergenic
1054446835 9:65377847-65377869 TAGGACAGGGACAGTCTTGTGGG + Intergenic
1054665559 9:67731976-67731998 TAGGACAGGGACAGTCTTGTGGG - Intergenic
1056829573 9:89904302-89904324 CATGACACTGACATTCTGCTGGG - Intergenic
1186742849 X:12535967-12535989 CAAGACAGAGAGACTTTTGTGGG + Intronic
1195084290 X:101399732-101399754 CATGAAACTTACACTCTAGTGGG + Intronic
1197778488 X:130136762-130136784 CATGAAAGTGATAGCCTTGTAGG - Intronic
1197885737 X:131216371-131216393 CATGACAGTGCCATGGTTGTTGG - Intergenic
1201798120 Y:17923938-17923960 CATGACTGTGACACCCTCTTAGG - Intergenic
1201803433 Y:17982019-17982041 CATGACTGTGACACCCTCTTAGG + Intergenic
1202359445 Y:24092629-24092651 CATGACTGTGACACCCTCTTAGG - Intergenic
1202511333 Y:25577485-25577507 CATGACTGTGACACCCTCTTAGG + Intergenic