ID: 919702374

View in Genome Browser
Species Human (GRCh38)
Location 1:200643908-200643930
Sequence ATGTGCTTGTGGAACTGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 212}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919702368_919702374 14 Left 919702368 1:200643871-200643893 CCTAATTCTCATTTATTCAACAG 0: 1
1: 0
2: 5
3: 31
4: 390
Right 919702374 1:200643908-200643930 ATGTGCTTGTGGAACTGTGGGGG 0: 1
1: 0
2: 1
3: 23
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919702374 Original CRISPR ATGTGCTTGTGGAACTGTGG GGG Intronic
900292037 1:1927733-1927755 ATATTCTTTCGGAACTGTGGGGG + Exonic
901153545 1:7120689-7120711 ATGGGCTTTGGGATCTGTGGTGG - Intronic
902126929 1:14222277-14222299 ATGCCCGTGGGGAACTGTGGGGG + Intergenic
904928923 1:34070917-34070939 ATGTAGCTGTGGAACTTTGGAGG + Intronic
905338038 1:37258652-37258674 GTGTGCCTGTTGACCTGTGGCGG - Intergenic
905385459 1:37600461-37600483 ATTTGCTTGTAAAACTGTTGAGG - Intergenic
906190166 1:43893716-43893738 AAGTTCTTGTGGAAGTGAGGAGG - Intronic
907816977 1:57928206-57928228 ATGTGCTTGAGGAACTTTTTGGG - Intronic
912595780 1:110874370-110874392 CTGTGCTTTGGGAATTGTGGGGG + Intronic
913932218 1:124986645-124986667 ATCTGCTTGTGGATATTTGGTGG - Intergenic
913932691 1:124997060-124997082 ATATGCTTGTGGATATTTGGAGG - Intergenic
917297165 1:173532551-173532573 ATGTGACTGTGGAGCTATGGAGG + Intronic
917624859 1:176835479-176835501 AAGTGCTTGTGAGAATGTGGAGG - Intronic
917944218 1:179952992-179953014 ATGTGCTTGGGGAATTTAGGAGG + Intergenic
919209347 1:194458170-194458192 AACTGCTTGTGGAAGTGTTGAGG + Intergenic
919510736 1:198460508-198460530 ATGTGCTCTGGGGACTGTGGTGG - Intergenic
919582255 1:199391225-199391247 TTGTGCATGTGGAAATGTAGAGG + Intergenic
919702374 1:200643908-200643930 ATGTGCTTGTGGAACTGTGGGGG + Intronic
924714293 1:246558257-246558279 AGCTGCTTGTGGGACTGAGGTGG - Intronic
1063673705 10:8120769-8120791 GTGAGCTTGTGCACCTGTGGAGG + Intergenic
1066515894 10:36160177-36160199 AGGTGCTTGGGGAGCTGAGGCGG - Intergenic
1067814009 10:49457809-49457831 ATGTGTTTGTGGTTCTGTGATGG - Exonic
1068214382 10:53964842-53964864 ATTTGCTTGTGAAAGAGTGGGGG + Intronic
1068281006 10:54869809-54869831 ATGTGCTAGTGGTTCTGTGAAGG - Intronic
1070097627 10:73353340-73353362 ATGTGTTAGTGGAAGTGTGCAGG - Intronic
1075851934 10:125596121-125596143 ATGTGCTGATGTAACTGTGGTGG + Intronic
1076106263 10:127826072-127826094 ATGTGCTGGGGAAACTGTGTGGG - Intergenic
1077866881 11:6229736-6229758 ATGGGATTGTAGAACTGCGGTGG - Intronic
1078997367 11:16716592-16716614 ATGTGCATGTGTTACTGTTGGGG - Intronic
1080498114 11:32841695-32841717 ATCTGCTTGTGGGGCTGAGGTGG + Intronic
1080665339 11:34331045-34331067 ATGTGCTGGTGGAACATAGGAGG - Intronic
1081043971 11:38249680-38249702 AGGATCTTGTGGAAGTGTGGTGG - Intergenic
1082394046 11:52133063-52133085 ATGTGCAAGTGGACCTTTGGAGG + Intergenic
1083420642 11:62550977-62550999 ATGGGGTTGGGGAACTGTGGTGG + Intronic
1085607469 11:77915238-77915260 ATTTTCTTGTTGAACTGTGAAGG + Intronic
1086788802 11:91007825-91007847 ATGTGATTGTGGTTATGTGGTGG + Intergenic
1087532306 11:99399621-99399643 AAGTGTTGGTGGAACAGTGGTGG + Intronic
1089651839 11:119919722-119919744 TTGTGCTTGTGGCACTATGCGGG + Intergenic
1089813792 11:121153965-121153987 CTGTGCTGGTGGTATTGTGGGGG + Intronic
1091634581 12:2187402-2187424 ATTTGCATGAGGAACTGAGGTGG + Intronic
1092080286 12:5710407-5710429 ATATTCTTTTGGAAATGTGGGGG - Intronic
1093583659 12:20811504-20811526 ATGTACCTATGGAACTGAGGAGG - Intronic
1093786099 12:23193641-23193663 ATGTTCTGGTGGCAATGTGGAGG - Intergenic
1094031754 12:26020170-26020192 ATGAGGCTGTTGAACTGTGGAGG + Intronic
1094865254 12:34524092-34524114 CTGTGTTTGTTGAACTGGGGTGG - Intergenic
1095034797 12:37348899-37348921 ATCTGCTTGTGGATATTTGGAGG - Intergenic
1095252080 12:39990668-39990690 AGGTGGTTGTGACACTGTGGGGG + Intronic
1095279411 12:40332821-40332843 ATGTGTTTGGGGAGCTATGGTGG + Intronic
1096333979 12:50739022-50739044 ATGTGTTCGTGGGACTCTGGAGG + Intronic
1096483344 12:51958380-51958402 ATGTGCTTGATGATCTGAGGTGG - Intronic
1098144360 12:67483854-67483876 CTGTGCTTGGGGCACTGTGCAGG + Intergenic
1099671703 12:85702071-85702093 ATGAGCATCTGGAACTGAGGGGG - Intergenic
1099841834 12:87975990-87976012 ATGGGCTTGTGCGATTGTGGAGG - Intergenic
1099951330 12:89307732-89307754 ATGGGCTGGTTGAACTTTGGAGG - Intergenic
1100956043 12:99909522-99909544 ATGTGTTGGTGAGACTGTGGAGG - Intronic
1101043702 12:100783171-100783193 ATCTGATTGAGGAAGTGTGGTGG + Intronic
1102329716 12:112018640-112018662 ATATACAAGTGGAACTGTGGTGG - Intronic
1102589031 12:113943367-113943389 AGGGGCTTGTGGCACTGTGTTGG - Intronic
1104566153 12:129886255-129886277 TTGTACTTTTGCAACTGTGGAGG + Intronic
1104728780 12:131093873-131093895 CTTTCCTTGTGGAGCTGTGGTGG + Intronic
1106836167 13:33637314-33637336 ATGTGGTGGTGGAAATGTAGAGG - Intergenic
1111259855 13:85723320-85723342 ATGTGCTTTTTGCACAGTGGTGG - Intergenic
1113571038 13:111358158-111358180 ATGTGCTTGTGGTATTGTGTGGG + Intergenic
1113820923 13:113212004-113212026 CTGTGCTTGTGGGTGTGTGGTGG + Intronic
1113948771 13:114059691-114059713 ATGTGCTTGTCTCACTGTGCAGG - Intronic
1114175709 14:20317832-20317854 CTTCGCTTGTGGAGCTGTGGAGG - Exonic
1114787487 14:25617303-25617325 ATGTGTGTGTGGACCGGTGGTGG + Intergenic
1115734029 14:36304120-36304142 ATGTGCGTGTGAACGTGTGGTGG - Intronic
1117104289 14:52382558-52382580 GTGTCTTTGTGGCACTGTGGTGG - Intergenic
1118059740 14:62122400-62122422 ATAGGCTTGTGGAACTGGTGGGG + Intergenic
1119137042 14:72230610-72230632 ATTGGCTTATGCAACTGTGGGGG + Intronic
1119419789 14:74501680-74501702 GTGCCCCTGTGGAACTGTGGGGG + Intronic
1120635153 14:86941942-86941964 ATGTGATTTTTGAACTGTTGAGG + Intergenic
1120681482 14:87485862-87485884 ATGTGCTCAGGAAACTGTGGTGG - Intergenic
1120889195 14:89476695-89476717 ATCTCCTGGTGGAAATGTGGCGG - Intronic
1122320589 14:100852931-100852953 GTGTCCTTTTGGAAATGTGGAGG + Intergenic
1122800558 14:104227342-104227364 TTATGCTTGTGCAACTTTGGGGG + Intergenic
1123427862 15:20187516-20187538 AGATGCTGCTGGAACTGTGGTGG - Intergenic
1126123576 15:45274945-45274967 ATGTTCTTGTGGCATTTTGGTGG + Intronic
1127692646 15:61412969-61412991 ATGTGTATGTGTATCTGTGGAGG - Intergenic
1129743373 15:78001091-78001113 GTGTGTTTGGGGAAGTGTGGAGG - Intronic
1130042656 15:80418165-80418187 ATGTGCTTGTTGAAGAGAGGGGG + Intronic
1133230691 16:4365132-4365154 AGGTCCTTGGGGACCTGTGGGGG - Intronic
1134140573 16:11714723-11714745 ATTTGCTTGTAGAACTGAGTCGG - Intronic
1136610225 16:31361590-31361612 GTCTGCTTGTAGACCTGTGGGGG + Intronic
1136856433 16:33662245-33662267 AGATGCTGCTGGAACTGTGGTGG + Intergenic
1137281029 16:46976878-46976900 GTATGCTTGTGTAACTGTGAAGG + Intergenic
1138140555 16:54564799-54564821 ATGAGCTGGTGGAAATGTGAAGG - Intergenic
1141651663 16:85396197-85396219 ATGGACTTGGGGAACTGGGGAGG - Intergenic
1142010703 16:87712370-87712392 ATGTGCTGGTGGGAATGAGGCGG - Intronic
1203118013 16_KI270728v1_random:1510722-1510744 AGATGCTGCTGGAACTGTGGTGG + Intergenic
1142540007 17:651476-651498 AGCTGCTTGGGAAACTGTGGTGG + Intronic
1142691544 17:1609181-1609203 ACGTGCTGGTGGGCCTGTGGTGG + Intronic
1153036754 18:770794-770816 GTGTGTTTGTGGAGGTGTGGGGG + Intronic
1153612559 18:6901045-6901067 ATGTCCTTCTGGAAATGAGGGGG + Intronic
1154946959 18:21171426-21171448 AGCTACTTGTGGGACTGTGGTGG + Intergenic
1156515219 18:37673622-37673644 ATCTCCTGGTGGAGCTGTGGGGG + Intergenic
1158515866 18:58129819-58129841 GTGATCTAGTGGAACTGTGGTGG + Intronic
1158515881 18:58129916-58129938 GTGATCTAGTGGAACTGTGGCGG + Intronic
1158515890 18:58129968-58129990 GTGATCTAGTGGAACTGTGGCGG + Intronic
1158515904 18:58130068-58130090 GTGATCTAGTGGAACTGTGGCGG + Intronic
1158516030 18:58130854-58130876 GTGATCTAGTGGAACTGTGGTGG + Intronic
1158516095 18:58131246-58131268 GTGATCTAGTGGAACTGTGGCGG + Intronic
1158516135 18:58131484-58131506 GTGATCTAGTGGAACTGTGGTGG + Intronic
1161252467 19:3287957-3287979 ATGTGACTGTGAAACGGTGGAGG + Intronic
1161332006 19:3692913-3692935 AGGGGGTTGTGGAAGTGTGGAGG - Intronic
1162993754 19:14320338-14320360 GTGTGCTTGTGAACCTGTTGTGG + Intergenic
1165084151 19:33331253-33331275 AACAGCTCGTGGAACTGTGGGGG + Intergenic
1168526529 19:57093043-57093065 AAGTGTTCGTGGATCTGTGGTGG - Intergenic
1168637089 19:58004629-58004651 ATGAGCTTGAGGGACTGAGGTGG - Intronic
1202637234 1_KI270706v1_random:52931-52953 ATGTTCATGTGGAATTGTAGTGG - Intergenic
925063553 2:911921-911943 GTGTGTCTGTGGAACTGAGGTGG - Intergenic
925854624 2:8117551-8117573 ATGTGCTTGGGGAAGTATTGGGG - Intergenic
928526012 2:32141356-32141378 ATATGCTTGTTTAAATGTGGAGG + Intronic
937295069 2:120805177-120805199 TTGTGCTTGGGGAAATGGGGCGG - Intronic
939166132 2:138643141-138643163 ATGTGCTGGGTGAACTGAGGAGG - Intergenic
940144158 2:150527813-150527835 CTGTGCTTGTGGAATTGTCAGGG - Intronic
940273806 2:151918557-151918579 ATGTGCTTGTGTAACAGTGGAGG - Intronic
940311783 2:152286793-152286815 AGCTGCTTGGGGAAATGTGGTGG - Intergenic
941677197 2:168356307-168356329 AGCTGCTTGTGGGACTGAGGTGG + Intergenic
943085975 2:183311697-183311719 ATTTGCTTTTGGAAGTGTGTTGG + Intergenic
943806150 2:192129200-192129222 ATGTGCTTGAGGAACTCTCAGGG - Intronic
1169213552 20:3781078-3781100 GTGTGCTTGTGGGAGTGGGGAGG - Intronic
1172112107 20:32553106-32553128 ATTTGCTGGTGGAAATGGGGCGG - Intronic
1172277658 20:33688738-33688760 CTGTGCTGGTTTAACTGTGGTGG + Intergenic
1173505004 20:43579875-43579897 AGTTGCTTGTGGAGCTCTGGAGG + Intronic
1175749617 20:61486228-61486250 ATCTGTTTGTAGAACTGTGCAGG - Intronic
1175815922 20:61883171-61883193 ATGTGGCTGTCGAGCTGTGGAGG - Intronic
1178724721 21:35040973-35040995 ATGTGCTTCTGAAAATGTGTAGG - Intronic
1179728670 21:43354981-43355003 GTGTGCGTGTGCATCTGTGGTGG - Intergenic
1179728685 21:43355071-43355093 GTGTGCGTGTGCATCTGTGGTGG - Intergenic
1180112866 21:45672422-45672444 TTCTGCTTGTGGAAGTTTGGAGG + Intronic
1180998666 22:19977843-19977865 ATGGGCTTGTGGGTCTGGGGTGG - Intronic
1182537839 22:31019176-31019198 ATCTACTTGGGGAGCTGTGGTGG - Intergenic
949164677 3:924692-924714 ATGTCCTTGTGGAACTGCTGAGG - Intergenic
949670640 3:6395951-6395973 ATGAGTTTGTTGCACTGTGGGGG - Intergenic
951187212 3:19727649-19727671 ATGTCCTTGTGGAAGAGTGAAGG - Intergenic
952086057 3:29822885-29822907 ATGTGCTTATGAAACACTGGAGG - Intronic
952341168 3:32448830-32448852 AAGTGCCTGTGGATGTGTGGTGG - Intronic
953141041 3:40229632-40229654 CTGTCCTTGTGGCTCTGTGGTGG + Intronic
955981044 3:64528268-64528290 ATGGGCATGGGGAGCTGTGGTGG + Intronic
956725088 3:72150426-72150448 GTGTGCATCTGGAACTATGGAGG - Intergenic
957335194 3:78818663-78818685 AAGTGCTTCTGGGAATGTGGTGG + Intronic
962250878 3:133835391-133835413 GTGTGTTTGTGTAAGTGTGGGGG + Intronic
964506892 3:157409473-157409495 TAGTGCTTGTGTCACTGTGGAGG - Intronic
965695539 3:171404304-171404326 ATGAGCTTCTGGAAATGTGGAGG - Intronic
965987741 3:174776427-174776449 AAGTGTCTCTGGAACTGTGGAGG - Intronic
966982932 3:185154055-185154077 ATGTGCTTGTGCACGTGTTGTGG + Intergenic
971214324 4:24649463-24649485 ATGTGTTTGTGGAGATGGGGTGG + Intergenic
972478998 4:39480215-39480237 ACGTGCCTGTGGCACTGAGGAGG + Intergenic
972491336 4:39590324-39590346 AATTGCTTGTGGAATTGAGGTGG + Intronic
978770819 4:112455042-112455064 TTGTGGTTGTAGAACTGAGGTGG + Intergenic
980902290 4:138916456-138916478 TTGTGGTTGTAGGACTGTGGGGG + Intergenic
982134061 4:152257272-152257294 CTGTGCTTGTGCTAGTGTGGAGG + Intergenic
983550294 4:169010464-169010486 ATGTACTTGTGGCACTGAGGGGG + Intergenic
985654282 5:1121879-1121901 ATGGGGTTGTGCAAGTGTGGGGG + Intergenic
985844735 5:2335814-2335836 ATGTGCTTGTGGACATTTGGTGG + Intergenic
986184552 5:5423226-5423248 ATGCGCTGGTGTAACGGTGGGGG + Intronic
986194339 5:5524363-5524385 ATGTGCTTGTAGACGTGTGTGGG - Intergenic
989883256 5:46827937-46827959 ATGTGCTTGTGGATATTTGGAGG + Intergenic
989890401 5:46968567-46968589 ATGTGCTTGTGGATATTTGGAGG + Intergenic
989897343 5:47108454-47108476 ATGTGCTTGTGGATATTTGGAGG + Intergenic
989897565 5:47112542-47112564 ATGTGCTTGTGGATATTTGGAGG + Intergenic
989897788 5:47116631-47116653 ATGTGCTTGTGGATATTTGGAGG + Intergenic
989898309 5:47126344-47126366 ATGTGCTTGTGGATATTTGGAGG + Intergenic
989898527 5:47130434-47130456 ATGTGCTTGTGGATATTTGGAGG + Intergenic
989898745 5:47134523-47134545 ATGTGCTTGTGGATATTTGGAGG + Intergenic
989898965 5:47138612-47138634 ATGTGCTTGTGGATATTTGGAGG + Intergenic
989899191 5:47142700-47142722 ATGTGCTTGTGGATATTTGGAGG + Intergenic
989899408 5:47146618-47146640 ATGTGCTTGTGGATATTTGGAGG + Intergenic
991045399 5:62217834-62217856 AGATGCTGCTGGAACTGTGGTGG - Intergenic
991452956 5:66772161-66772183 ATGTCCTTGAGGTACTGGGGAGG + Intronic
993692317 5:91017379-91017401 ATGTACCAGTGGATCTGTGGGGG + Intronic
995136735 5:108687181-108687203 AGCTACTTGTGGAACTGAGGTGG - Intergenic
997121419 5:131176964-131176986 AGGTGCTAGTAGAACTGTGAGGG - Intronic
997208138 5:132062218-132062240 GTGGGCTTGGGAAACTGTGGGGG + Intronic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
998168557 5:139858651-139858673 CTGTGCAGGTGGAACTGTGAGGG - Intronic
998682618 5:144487200-144487222 ATGTCATTCTGGAACAGTGGAGG - Intergenic
999075983 5:148795995-148796017 CTGTGGTTGTGGAAATGTAGAGG + Intergenic
999850162 5:155529061-155529083 ATGTGCTTGTGTAAGTGTAGAGG + Intergenic
1001018340 5:168161889-168161911 ATGTGCTCGGGGAAGGGTGGTGG - Intronic
1001611603 5:173007345-173007367 ATGTGCTTATAGAACTGAGATGG + Intronic
1001994423 5:176144262-176144284 ATGGGCTTGTGGAACTCAGCTGG - Intergenic
1003403461 6:5809666-5809688 ATGTGCTTGTGGATGTGTGCAGG + Intergenic
1005533203 6:26729301-26729323 ATGTGGTTGGGGAAGAGTGGAGG - Intergenic
1005537591 6:26772363-26772385 ATGTGGTTGGGGAAGAGTGGAGG + Intergenic
1005734804 6:28735420-28735442 ATGTACTTGTGGAAGTGCTGGGG + Intergenic
1006276489 6:33008597-33008619 GTGAGCTGGTGGGACTGTGGGGG + Intronic
1007591667 6:43024968-43024990 ATGTGCCTGTGGAAGTGGGGAGG - Exonic
1008307298 6:49918850-49918872 ATGAGCTGGTGGAAGTGTGATGG - Intergenic
1008760464 6:54846893-54846915 AGGTGCTTGGGGTACTGGGGGGG + Intronic
1009008466 6:57814773-57814795 ATGTGGTTGGGGAAGAGTGGAGG + Intergenic
1017867660 6:158457994-158458016 ACGTGCATGTGGAGCAGTGGGGG - Intronic
1018182103 6:161232901-161232923 ATGTGCTGGAGAAACAGTGGTGG - Intronic
1020456630 7:8381011-8381033 ATGTGCAGGTGGACATGTGGAGG + Intergenic
1021600404 7:22357829-22357851 ATGTGCTTGGTGAACTGTAAAGG + Intergenic
1021955230 7:25817852-25817874 ATATTCTTGTGGAACAGTTGTGG - Intergenic
1022376283 7:29814518-29814540 ATGTGCTTGTCGAAGGCTGGGGG + Intronic
1022846175 7:34212282-34212304 GTGTGCATGTGGAAGTGTGGAGG - Intergenic
1025845483 7:65192691-65192713 ATTTTCTTGTTGAACTGTGAAGG - Intergenic
1025895760 7:65698723-65698745 ATTTTCTTGTTGAACTGTGAAGG - Intergenic
1028874918 7:95810651-95810673 ATGTGTTTTTGGAATTGAGGGGG + Intronic
1032543225 7:132721551-132721573 ATGTGCCTGTGGTACTTGGGAGG + Intronic
1032965624 7:137093804-137093826 ATGTGCTGGTGGCAGTGGGGTGG - Intergenic
1034262015 7:149763172-149763194 ATGTGCTTCTGAAGCTATGGGGG - Intergenic
1035291153 7:157839682-157839704 ATGTGTATGTGCAACTGTGTGGG + Intronic
1035647831 8:1242234-1242256 ATGTGTTTGTGGAAGAGGGGAGG + Intergenic
1035773165 8:2166069-2166091 ATGGGCTTGAGGAGCTGTGAAGG + Intergenic
1038589650 8:28824979-28825001 ATGTGCTTCTGGGGCTGTGTTGG - Intronic
1042478227 8:69274281-69274303 AGGTGCCTGTGAAACTGAGGTGG + Intergenic
1043536905 8:81215097-81215119 AGGGGCTTGAGGAACTTTGGAGG + Intergenic
1046447680 8:114345076-114345098 ATGTGGTTATGTAACTGTGCTGG - Intergenic
1046687731 8:117245674-117245696 AAGTGCTTGTGGAACAGCTGTGG + Intergenic
1047875621 8:129134239-129134261 CTGTGCTAGAGGAGCTGTGGTGG + Intergenic
1049918642 9:343136-343158 TTGTGCATCTGGAAATGTGGGGG - Intronic
1050259497 9:3826657-3826679 TTCCGCTTGTGGGACTGTGGAGG + Intronic
1051165212 9:14254622-14254644 ATGGGCTTTTGGATCAGTGGAGG - Intronic
1052289126 9:26822749-26822771 ATATGCTTGTGAAAATATGGAGG - Intergenic
1054726024 9:68651020-68651042 ATGTGCATGTGAATCTGTCGGGG + Intergenic
1055195591 9:73589088-73589110 CTGTGCTTGTGAAACTGTAGAGG + Intergenic
1059610420 9:115886544-115886566 ATGTCCTTTTTGAACAGTGGTGG + Intergenic
1061391486 9:130319525-130319547 ATGTCACTGTGGAACTGGGGAGG + Intronic
1062222890 9:135428153-135428175 ATGAGCGTGTGGAAATTTGGAGG + Intergenic
1203769983 EBV:44955-44977 AGGTGCTTGTGGAAGTCTTGCGG + Intergenic
1186227329 X:7413814-7413836 ATGAGCTTGTTGCAATGTGGGGG + Intergenic
1190217833 X:48492015-48492037 GTGTGCATGTGTAACTCTGGAGG + Intergenic
1192903414 X:75523486-75523508 GTGTGTGTGTGTAACTGTGGGGG - Intronic
1193399295 X:81022853-81022875 ATGTGCGTGTGTATTTGTGGTGG - Intergenic
1193851790 X:86546212-86546234 ATCTGCTGGTGGAATTTTGGTGG - Intronic
1194264125 X:91734342-91734364 ATGGGCTTTAGGAACTCTGGGGG - Intergenic
1197433852 X:126400707-126400729 ATGTGCTTGTGTTGCTATGGGGG + Intergenic
1197872113 X:131070469-131070491 ACTTGGTTGTGGAACTGGGGAGG - Intronic
1200052219 X:153440198-153440220 ATGTGTGTGTGCAAGTGTGGGGG + Intergenic
1202030104 Y:20562553-20562575 AGGTGGTTGTGAAACTCTGGTGG + Intergenic
1202329954 Y:23738859-23738881 TTGTGCTTGGGGCACTGTTGTGG - Intergenic
1202540816 Y:25931195-25931217 TTGTGCTTGGGGCACTGTTGTGG + Intergenic