ID: 919713238

View in Genome Browser
Species Human (GRCh38)
Location 1:200749331-200749353
Sequence GCCATGGGCATTGTGTTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 186}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919713232_919713238 14 Left 919713232 1:200749294-200749316 CCTGCCACAGCTGTAGCTTGCCA 0: 1
1: 0
2: 1
3: 20
4: 193
Right 919713238 1:200749331-200749353 GCCATGGGCATTGTGTTCCTTGG 0: 1
1: 0
2: 1
3: 21
4: 186
919713233_919713238 10 Left 919713233 1:200749298-200749320 CCACAGCTGTAGCTTGCCACAAG 0: 1
1: 0
2: 1
3: 4
4: 92
Right 919713238 1:200749331-200749353 GCCATGGGCATTGTGTTCCTTGG 0: 1
1: 0
2: 1
3: 21
4: 186
919713234_919713238 -6 Left 919713234 1:200749314-200749336 CCACAAGCCTGATGATAGCCATG 0: 1
1: 0
2: 0
3: 6
4: 81
Right 919713238 1:200749331-200749353 GCCATGGGCATTGTGTTCCTTGG 0: 1
1: 0
2: 1
3: 21
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919713238 Original CRISPR GCCATGGGCATTGTGTTCCT TGG Intronic
900598036 1:3491267-3491289 CCCATGGGCAGTGTGTTGCTGGG - Intronic
901240947 1:7692859-7692881 GCCCTGGGCTGTGAGTTCCTGGG - Intronic
901770897 1:11529882-11529904 GCCATGGTCTTTGTGGTCTTCGG + Exonic
904927680 1:34061428-34061450 GCCAGGGGCATGGTCTTCCATGG - Intronic
905882395 1:41473157-41473179 GAAAAGGGCTTTGTGTTCCTAGG + Intergenic
907393417 1:54173741-54173763 CCCAGGGGCACTGGGTTCCTGGG + Intronic
908811197 1:67983935-67983957 GTCATGGTCATTATGATCCTGGG - Intergenic
909548836 1:76876351-76876373 ACCATGGCCATTTTGTTCATGGG + Intronic
909672806 1:78207846-78207868 TCCCTGTGCATTGTATTCCTAGG - Intergenic
911883687 1:103271309-103271331 ACCATGGCCACTGTGTTCATGGG - Intergenic
911980534 1:104560270-104560292 ACCATGGACACTGTGTTCGTGGG - Intergenic
912129797 1:106587210-106587232 ACCATGGACACTGTGTTCATGGG + Intergenic
915004461 1:152623429-152623451 GTCATGGGCGTTGTGTTCACGGG - Intergenic
916453446 1:164944537-164944559 GCCTTGGGCAATGATTTCCTAGG - Intergenic
919330317 1:196162774-196162796 ACCATGGACATTTTGTTCATGGG - Intergenic
919713238 1:200749331-200749353 GCCATGGGCATTGTGTTCCTTGG + Intronic
922002062 1:221489145-221489167 GCCAAGGCCACTGTCTTCCTGGG + Intergenic
922539210 1:226406538-226406560 GCTCTAGGCATTGTGTGCCTAGG - Intronic
923272650 1:232372002-232372024 TCCAAGGGCTTTGGGTTCCTCGG - Intergenic
1064757304 10:18582775-18582797 GACATGGGCATAGTACTCCTGGG - Intronic
1066317899 10:34267187-34267209 CCCATTGGAATTGTTTTCCTGGG - Intronic
1068864919 10:61884669-61884691 GTCATGGGAATTTTGGTCCTAGG - Intergenic
1069882629 10:71603211-71603233 GCCATGGGCTTTCTTCTCCTTGG + Intronic
1070548490 10:77472267-77472289 GACATGTGCATAGTGTGCCTAGG - Intronic
1070560199 10:77560586-77560608 GCCATGGGCATTGGGATTCTGGG + Intronic
1071806727 10:89130071-89130093 GCCATGGGCATGATTTTCTTGGG - Intergenic
1074310831 10:112321970-112321992 GCCTTGGTCCTTGTGGTCCTTGG - Intergenic
1074559079 10:114519194-114519216 CCAATGGGCTGTGTGTTCCTAGG + Intronic
1075721942 10:124592596-124592618 GCCATGGGCATGGTGGTGGTTGG - Intronic
1078822561 11:14896418-14896440 GCCATGGTCCCTGTGTTCCTGGG + Intergenic
1078836878 11:15038797-15038819 GCTATGGGTATTATTTTCCTGGG + Intronic
1081110639 11:39129558-39129580 GCCATGGCCACTTTGTTCATGGG - Intergenic
1081494636 11:43596324-43596346 GAGATGGGTATTGAGTTCCTGGG + Intronic
1084857308 11:71997470-71997492 GCCTTCGGCATTGGGTTTCTAGG + Exonic
1086091550 11:83009569-83009591 TCCCTGGGCATGTTGTTCCTGGG - Intronic
1086357172 11:86014416-86014438 CCCAAGGGCATTGTGTTCGCTGG - Intronic
1090314347 11:125771738-125771760 GCCATTGGCTTAATGTTCCTGGG + Intergenic
1090455141 11:126842570-126842592 CACATGAGCACTGTGTTCCTAGG - Intronic
1091608814 12:1985086-1985108 GTCATGGGCATGGTTTTCTTTGG + Intronic
1091708779 12:2722256-2722278 GCCATGGCCATTTTGTTCGTGGG - Intergenic
1092280804 12:7096479-7096501 GCCACGGGCATTGTGTCCTGGGG - Exonic
1092481587 12:8863968-8863990 CCCATATGCATTGTGTTGCTTGG - Exonic
1093247858 12:16762243-16762265 GACATGGGCACTGTGATACTGGG - Intergenic
1093564990 12:20591450-20591472 GCCATGAGCATTGAGATGCTAGG - Intronic
1095296662 12:40534849-40534871 TCCATGTGTATCGTGTTCCTTGG - Intronic
1098602204 12:72345661-72345683 GTCATGGGATTTGTGTTCTTGGG + Intronic
1099299202 12:80870107-80870129 ACCATGTGCATTGAGATCCTAGG - Intronic
1099490562 12:83283429-83283451 ACCATGGCCATTTTGTTCATGGG + Intergenic
1103727054 12:123003229-123003251 GCCATGAGCCTGGTGGTCCTGGG - Intronic
1107079730 13:36362046-36362068 GACATGGGTATTGTTTGCCTGGG - Intronic
1107572453 13:41677123-41677145 GGCATGGGGATTGTGTTTTTTGG + Intronic
1107983968 13:45758959-45758981 ACCAGGTTCATTGTGTTCCTTGG + Intergenic
1108975451 13:56438519-56438541 GCCATGGGGATAGAGTTTCTGGG - Intergenic
1110204148 13:72891684-72891706 GACATAGCAATTGTGTTCCTAGG + Intronic
1110277406 13:73655621-73655643 GTCATGGTCACTGTGTTCCTAGG - Intergenic
1110484904 13:76027399-76027421 GTCATGGGGATTGCATTCCTAGG - Intergenic
1113639283 13:111945521-111945543 GCCATGCGCATTGTTCACCTGGG - Intergenic
1113769533 13:112899257-112899279 CCCCTGGGCTTTGTGGTCCTGGG - Intronic
1118973878 14:70660898-70660920 GAAATGGCCATTGGGTTCCTAGG - Intronic
1120254970 14:82106931-82106953 TTCATGGTCATTGAGTTCCTTGG + Intergenic
1120959586 14:90112198-90112220 GCCATTTACATTGTGTTCCGTGG + Intronic
1122615399 14:103014216-103014238 GCCTTGTGCTCTGTGTTCCTGGG - Intronic
1125404934 15:39342198-39342220 GGCATGTGCATTTTGTTTCTGGG - Intergenic
1126220143 15:46204196-46204218 GACTTGGGAATTGTGTTGCTTGG - Intergenic
1128349457 15:66879505-66879527 CCCAGGGGCAATGTGTTCCACGG + Intergenic
1130829060 15:87581069-87581091 GGCTGGGCCATTGTGTTCCTTGG + Intergenic
1131091126 15:89625564-89625586 GCCTTAGGCATGCTGTTCCTGGG - Exonic
1134160337 16:11883073-11883095 GATATGGGCACTGTGGTCCTGGG - Exonic
1135858732 16:26035786-26035808 GCCATTGACTCTGTGTTCCTGGG + Intronic
1135926048 16:26694961-26694983 GCAATGGGCACTGAGTCCCTAGG + Intergenic
1136298818 16:29319703-29319725 GCCAGGTGCATTGTCTTCCTGGG - Intergenic
1136553104 16:30992175-30992197 GCCATGGCCTGTGTGTACCTGGG + Exonic
1138618046 16:58187795-58187817 GCCATGGGCTCTGTGATCTTGGG - Intronic
1139270024 16:65673211-65673233 GCCATGAGCATTGTGATCCTTGG - Intergenic
1141720684 16:85753624-85753646 GCCAAGGGCATGGTGCTCCCAGG - Intergenic
1141721765 16:85759875-85759897 GGCATGGGCAGTGTGATCCTCGG + Intergenic
1142060487 16:88026201-88026223 GCCAGGTGCATCGTCTTCCTGGG - Intronic
1144804016 17:17951991-17952013 GACATGAGCATTTTGTCCCTAGG + Intronic
1150266830 17:63837588-63837610 GCCATGGGCATCCGGTTCCCTGG + Exonic
1151206354 17:72510750-72510772 GTCCTGGGCATTGTTTTGCTTGG - Intergenic
1156803322 18:41145333-41145355 GCCTTGTGGATTGTCTTCCTTGG - Intergenic
1159315832 18:66772160-66772182 GCCATGGGCATTTTGTAAGTAGG - Intergenic
1161359222 19:3837346-3837368 GTCATGGTCATGGTGTTCATCGG - Intronic
1161749124 19:6081417-6081439 GCAATGGGCTTAGTGTTACTTGG - Intronic
1161801843 19:6420640-6420662 GCTCTGGGCATTGTGGGCCTTGG + Intronic
1162939371 19:13998891-13998913 CCCATGGGCTTTGTATCCCTAGG - Intronic
1163688678 19:18726411-18726433 GCCATGGGCATCTGCTTCCTTGG + Intronic
1167043991 19:47039440-47039462 GCCCTGGGCCTTGTGGCCCTCGG + Exonic
1168542334 19:57223488-57223510 GCCATGGGCCTTGTGTTGACTGG + Intergenic
928950801 2:36811530-36811552 GTAATGAGCATTGTGTTCCTGGG + Intronic
929310761 2:40421669-40421691 GGAATAGGCATTGTGTTCTTTGG - Intronic
932888653 2:75570926-75570948 GCCATGTGAGTAGTGTTCCTGGG - Intergenic
935442116 2:103111611-103111633 GCCATGAGCTTAGTGTTTCTTGG + Intergenic
938343260 2:130549261-130549283 GCCATGGGCTGTGTGCTCCCGGG - Intronic
938346573 2:130571461-130571483 GCCATGGGCTGTGTGCTCCCGGG + Intronic
943663072 2:190579597-190579619 GCAGTGGACATTTTGTTCCTTGG - Intergenic
944062183 2:195581752-195581774 CCCATGGGCCTTGTCCTCCTGGG - Intronic
946373043 2:219292118-219292140 GCCCTGGGCATAGTGTTCCCTGG + Intronic
948441780 2:237996353-237996375 AGCATGGGCTTTGTGGTCCTTGG + Intronic
948824946 2:240569506-240569528 GCCATGGAGATTGTGATGCTCGG + Intronic
1169049857 20:2566749-2566771 GACCAGGGCATTGAGTTCCTTGG + Intronic
1169189829 20:3651548-3651570 GCCGTGGCCAGTGTTTTCCTCGG + Intergenic
1169517473 20:6333232-6333254 GCCACTGGAATTGTGTACCTAGG + Intergenic
1169995102 20:11547320-11547342 GACATGAGCAGTGTATTCCTGGG + Intergenic
1170296783 20:14835586-14835608 CCCATAGGCACTGTGCTCCTGGG - Intronic
1172149523 20:32780228-32780250 GCCATGGGCTCTGTGTTCTCAGG - Intronic
1173341330 20:42155319-42155341 GCCAAGGGCCTTGGGCTCCTAGG - Intronic
1173369692 20:42424343-42424365 TCCAAGGGCATTGTTATCCTAGG + Intronic
1173585035 20:44175918-44175940 TCCATGGGCATTGGGTTTCTGGG - Intronic
1176515690 21:7781769-7781791 GCCATGGGCCCTGTGTGCCATGG + Intergenic
1178649718 21:34411781-34411803 GCCATGGGCCCTGTGTGCCATGG + Intergenic
1179232729 21:39519640-39519662 GCCGTGGGCAGTGTGCGCCTTGG + Intergenic
1179431249 21:41322788-41322810 GCTATAGGCACTGTGCTCCTGGG - Intronic
1181120459 22:20664456-20664478 GCCATAGCCACTGTGGTCCTTGG - Intergenic
1181736647 22:24886740-24886762 GCCATGGGCACTGGGATCTTTGG + Intronic
1183311801 22:37113837-37113859 GCAATGGGCATTGTATTCGTTGG - Intergenic
1183589960 22:38774304-38774326 GCCATTGGGATTGTCTTTCTGGG + Intronic
1183931028 22:41236392-41236414 GGCATGGACATGGTGTGCCTGGG + Intronic
1183996426 22:41636690-41636712 GCCATGGGGGTTGTCTTCATTGG - Exonic
1184301578 22:43563875-43563897 GGCATGGCCACTGTGTGCCTGGG - Intronic
949146055 3:701291-701313 GCCAATAGAATTGTGTTCCTTGG + Intergenic
949273518 3:2249782-2249804 GCAAGGGGCATTGTGGTACTAGG - Intronic
956900475 3:73710501-73710523 GTCATGGGCTTTGTGTTCTGTGG + Intergenic
958480798 3:94643464-94643486 GTCATTGGAATTGTGTACCTAGG + Intergenic
960902256 3:122564560-122564582 GCCCGGGGCTTCGTGTTCCTGGG - Exonic
961610341 3:128132389-128132411 GCCCTGGGTATTGTCTTGCTAGG - Intronic
961858885 3:129898197-129898219 GCCAATGCCATTCTGTTCCTTGG + Intergenic
962892697 3:139686407-139686429 GCCAAGGCCATTCTGTTCTTTGG - Intergenic
965164680 3:165181658-165181680 GACTTGGGCATTTTGTTACTGGG + Intergenic
966223022 3:177569323-177569345 GCCATGTATTTTGTGTTCCTTGG + Intergenic
967125216 3:186417136-186417158 GACATGGACATTTTTTTCCTTGG - Intergenic
969099626 4:4759224-4759246 TTCATGGTCATTGTTTTCCTTGG + Intergenic
969815638 4:9685382-9685404 GCTATTGGCATCTTGTTCCTGGG - Intergenic
971151057 4:24031948-24031970 ACCATGGGCATTGTGGTCTGAGG - Intergenic
971687275 4:29786268-29786290 ACCATGGCCACTGTGTTCATGGG + Intergenic
972688898 4:41377569-41377591 GAGATGGGCATTGGGTTCCTTGG + Intronic
974369597 4:60998478-60998500 GCCATTTGTATTGTGTTCTTTGG + Intergenic
981029397 4:140108895-140108917 GGGCTGGGCAGTGTGTTCCTTGG - Intronic
983582795 4:169325633-169325655 ACCATGGGCACTTTGTTCTTGGG - Intergenic
984727524 4:183035914-183035936 TCAATAGGCATTGTGTTACTTGG - Intergenic
985833434 5:2252419-2252441 GCCAAGGGCTTTGGCTTCCTGGG - Intergenic
986766270 5:10931124-10931146 ACCATGGCCATTTTGTTCATGGG - Intergenic
988376326 5:30439947-30439969 GCAGTGGGCACCGTGTTCCTTGG + Intergenic
989024143 5:37046366-37046388 GTCATGGCCATTGACTTCCTGGG + Intronic
989103733 5:37841927-37841949 GCCCTGGGCATTGTGCTGATTGG + Intergenic
990080460 5:51906575-51906597 GCATAGGACATTGTGTTCCTGGG + Intergenic
991181521 5:63756689-63756711 GACATGGGCATTGTGCTCCCAGG - Intergenic
995411285 5:111859813-111859835 GCCATGGCAATTCTGTTTCTTGG + Intronic
996629480 5:125610105-125610127 GCCATGAGCGTTTTCTTCCTGGG - Intergenic
997356792 5:133267570-133267592 ACCATGGCCATAGTGCTCCTGGG + Intronic
997450553 5:133979287-133979309 GGCATGGGAAGTGTTTTCCTTGG - Intronic
997845393 5:137281560-137281582 GCCATGGGCTATGTGTTGGTGGG - Intronic
998507848 5:142686369-142686391 GCCAATGGCTCTGTGTTCCTGGG - Intronic
1000667319 5:164014827-164014849 GTCATGGCCATTTTGTTCCTGGG + Intergenic
1001887564 5:175309216-175309238 CCCATGAGCATTATTTTCCTGGG - Intergenic
1003066959 6:2912003-2912025 GCCATGGCCATGGTGCTCATAGG - Intergenic
1004253146 6:14039058-14039080 GTCATGGGCATTCTGTTACCAGG + Intergenic
1004824176 6:19402413-19402435 ACCATGGCCATTTTGTTCATGGG + Intergenic
1005840710 6:29743127-29743149 GTCCTGGGGACTGTGTTCCTGGG + Intergenic
1007256813 6:40535456-40535478 GCCATTGCCTTGGTGTTCCTTGG + Intronic
1009463932 6:63948789-63948811 GCAATGGGCATTCTGTATCTGGG + Intronic
1010107836 6:72189751-72189773 ACCATGGCCACTGTGTTCATGGG + Intronic
1010818740 6:80389229-80389251 ACCATGGGCATTTTGTTCGTGGG - Intergenic
1014250727 6:119113134-119113156 GGCATGGCCATTGTGCTCATGGG + Intronic
1016426481 6:143941512-143941534 GCCATGGGCACTGTGAGCCTGGG - Exonic
1020136372 7:5590329-5590351 GACATGGACGCTGTGTTCCTGGG - Intergenic
1024618736 7:51138808-51138830 GCCATGGACATCGTGTTTCTGGG - Intronic
1027996103 7:85427122-85427144 GCCATGGGCCTTGTGCTCTAAGG + Intergenic
1030368867 7:108674849-108674871 GCCATGGCCATTTTGTTCATGGG - Intergenic
1031168945 7:118267403-118267425 CCCATGGGCATGGTGTTCCCTGG + Intergenic
1031474816 7:122208343-122208365 ACCAATGTCATTGTGTTCCTTGG + Intergenic
1032506966 7:132442889-132442911 GCCTTGGGCACTGTGTCCCGGGG - Intronic
1034214725 7:149396542-149396564 GCCATGGGCCATGAGTTCCATGG + Intergenic
1034729608 7:153374899-153374921 GTGATGGGCATTATGATCCTGGG - Intergenic
1035192347 7:157182466-157182488 GGTCTGGGCAGTGTGTTCCTGGG + Intronic
1035281291 7:157779985-157780007 TCCATGGACATTGTGGACCTTGG - Intronic
1035961656 8:4144846-4144868 ACCAGGGGAATTGTGTCCCTGGG + Intronic
1038863534 8:31414061-31414083 TCCATGGTCTTTGTGTTCCCTGG + Intergenic
1039185789 8:34914636-34914658 GTCATGGGCCTTGTGTACTTGGG - Intergenic
1039763934 8:40608284-40608306 CCCATGGGAGTTATGTTCCTAGG + Intronic
1039991139 8:42488835-42488857 GCCATGTGTATTGTCTTCTTTGG + Intronic
1041126088 8:54640562-54640584 GCCTTGGGCCTTATATTCCTGGG + Intergenic
1041216171 8:55603061-55603083 GCCATGGGTTTTGTTTTTCTTGG - Intergenic
1042173633 8:66017173-66017195 GACTTGAGCATTGTGTTTCTTGG + Intergenic
1043513664 8:80976186-80976208 GCCGGGGGCATTGTGGTCCTTGG + Exonic
1045281207 8:100751077-100751099 GTCATGGCCATCGTGTTGCTTGG + Intergenic
1045830464 8:106453823-106453845 CCCATGTGCATTGTGCACCTAGG - Intronic
1046726377 8:117678912-117678934 GCCATGGGCATTGAAAACCTGGG - Intergenic
1047502640 8:125454084-125454106 GCCAGGGGCGTTGTGTTTTTGGG + Intergenic
1048171768 8:132113882-132113904 GACAAAGGCATTGTTTTCCTAGG - Intergenic
1049215391 8:141405454-141405476 GCCCTGGTCACTGTGTTGCTGGG + Intronic
1049844165 8:144792110-144792132 GCCATGGGCCGTGTGATCCGTGG - Exonic
1052227694 9:26109191-26109213 ACCATGGCCACTTTGTTCCTGGG - Intronic
1056692547 9:88820189-88820211 GACAAGGGCATTGTGTTCTGTGG + Intergenic
1058259151 9:102808867-102808889 ACCATGGGCACTTTGTTCATGGG + Intergenic
1059550148 9:115220895-115220917 GCCATTGTGATTGTGTTCCAAGG + Intronic
1060808075 9:126590852-126590874 GCCAAGGGCATTGTGTATCGAGG + Intergenic
1190567478 X:51744947-51744969 GATATGGGCACTGTGGTCCTGGG + Exonic
1192312154 X:70025973-70025995 GCCATGAGGATTGGGTTTCTTGG + Intronic
1193077000 X:77364950-77364972 GCCAATGGAATTGTGTACCTAGG - Intergenic
1193579869 X:83251621-83251643 GCCATGGGTGTTGTGTCCTTGGG + Intergenic
1194380917 X:93190819-93190841 GCCATTGGAGTTATGTTCCTAGG - Intergenic
1194834059 X:98659617-98659639 ACCATGGCCACTTTGTTCCTGGG - Intergenic
1196761335 X:119203253-119203275 CCCAAGGGCATTGTTTTTCTAGG - Intergenic
1198262987 X:134983074-134983096 GCCATGGGCATTTTGTACATTGG + Intergenic
1199682100 X:150232370-150232392 GCCATGGGGGTTGTCTTCATTGG + Intergenic
1199699445 X:150364873-150364895 GCCTGGGGAATTGTGTTCCCTGG + Intronic
1201065118 Y:10089505-10089527 GCCATGGGCCAGGTCTTCCTTGG - Intergenic
1201324871 Y:12745414-12745436 TCCAAGAGCATGGTGTTCCTAGG + Intronic