ID: 919721327

View in Genome Browser
Species Human (GRCh38)
Location 1:200839695-200839717
Sequence CAGGGAAAAAAGCAGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1061
Summary {0: 1, 1: 0, 2: 7, 3: 103, 4: 950}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919721317_919721327 25 Left 919721317 1:200839647-200839669 CCATAAGGATGCAAAGGCATAAG 0: 1
1: 28
2: 39
3: 48
4: 162
Right 919721327 1:200839695-200839717 CAGGGAAAAAAGCAGGAGGGAGG 0: 1
1: 0
2: 7
3: 103
4: 950

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919721327 Original CRISPR CAGGGAAAAAAGCAGGAGGG AGG Intronic
900391503 1:2435956-2435978 GAGGGAAGAAGGGAGGAGGGAGG - Intronic
900702286 1:4055787-4055809 CAGGGAGAGAAACAGGAGGCAGG - Intergenic
900704730 1:4073251-4073273 AAGGGGAAAAAGAAGGAGAGTGG + Intergenic
900711878 1:4119590-4119612 CAGGGAGACAGGCAGGAGGAGGG + Intergenic
900774474 1:4571895-4571917 GAGGGAGAAGGGCAGGAGGGAGG + Intergenic
900852834 1:5157496-5157518 CTGGGAACAAAACAGGAGTGTGG - Intergenic
900862958 1:5246077-5246099 GAGGGAGAAAAGAAGGAAGGAGG - Intergenic
900892318 1:5458402-5458424 AAGGAAAGAAAGAAGGAGGGAGG - Intergenic
900912945 1:5615023-5615045 CAGGGAATATAGCAGGATGAAGG + Intergenic
900932866 1:5747748-5747770 GAGGGAGAAAGGGAGGAGGGAGG + Intergenic
901002816 1:6157096-6157118 CAGGGAAGGAAGAAGAAGGGTGG - Intronic
901049691 1:6420001-6420023 CAGGAACAAAGGCAGGAGGTGGG - Intronic
901286835 1:8087107-8087129 ATGGGGAAAAGGCAGGAGGGAGG - Intergenic
901411269 1:9085891-9085913 CAGGGAGAAAAGCTGAAGGGAGG + Intronic
901872646 1:12147061-12147083 GAGGGAAAAAAGGAGGTGAGGGG + Intergenic
901945811 1:12702640-12702662 CAGGGCAAACAGCAGGTGGAGGG - Intergenic
903185895 1:21628887-21628909 CAGAAAAAAAAAAAGGAGGGGGG + Intronic
903577019 1:24345360-24345382 CAGGGAGAAAAGCAGGCTGGGGG - Intronic
903785135 1:25856041-25856063 CAGGGAAAAAGGCAGGATTTGGG + Intronic
903952136 1:27002005-27002027 CAGGGAACAGAGCAGAAGTGTGG + Intergenic
904324565 1:29719943-29719965 AAGGGAAAGCAGCACGAGGGTGG - Intergenic
904480736 1:30791724-30791746 GAGGGAAGAAGGAAGGAGGGAGG + Intergenic
904836107 1:33338006-33338028 CAGCGAAAGAGGCAGGAGGTGGG - Intronic
905037127 1:34925536-34925558 GAGGGGAAGAAGCAGGAGCGAGG + Intronic
905835816 1:41119841-41119863 GAGGGAAAAAAGGAGGAGGCAGG - Intronic
905883644 1:41480239-41480261 CAGGAGAAAAGGCAGGATGGTGG - Intronic
905923778 1:41735882-41735904 GAAGGAAGCAAGCAGGAGGGTGG + Intronic
905935123 1:41817377-41817399 CAGGGAAAAAAGGATGGGGCCGG + Intronic
905944065 1:41887198-41887220 CAGGGAAAAAAGTATTATGGAGG + Intronic
906224925 1:44113926-44113948 CAGGGAAAATGGCAGTGGGGTGG + Intergenic
906370671 1:45250647-45250669 GAAGGAAGAAAGAAGGAGGGAGG + Intronic
906562652 1:46770507-46770529 CAGGGGAAAAGGGTGGAGGGTGG - Intronic
906674202 1:47681420-47681442 CTCGGAGAAAAGCAGGAGAGAGG + Intergenic
907133422 1:52117471-52117493 CAGGGAAAAAACCAGAGGGATGG + Intergenic
907336311 1:53702108-53702130 CATGGGCAAATGCAGGAGGGGGG - Intronic
907341094 1:53736977-53736999 AAGGGAAAAAAAAAGGGGGGAGG + Intergenic
907387007 1:54132514-54132536 AAGGAAGAAAAGAAGGAGGGAGG + Intergenic
907572150 1:55493168-55493190 AAGGGAGGAAAGCAGGAGGAGGG - Intergenic
907770105 1:57452995-57453017 AAAAGAAAAAAGAAGGAGGGAGG + Intronic
907866552 1:58404853-58404875 CAGGGAAGAAGGAAGGAGAGTGG - Intronic
907909252 1:58812875-58812897 CAGGGAAAAGAGGAGGATGATGG - Intergenic
908106498 1:60848557-60848579 CCTGGGAAAAAACAGGAGGGTGG + Intergenic
908306149 1:62819281-62819303 CTGGGAAAAAAGCAGGAGATTGG + Exonic
908792997 1:67801936-67801958 GAAGGAAAAAAGAAGGAAGGGGG + Intronic
909339124 1:74511847-74511869 CAGGGACAAAGGCAGGAAAGTGG + Intronic
909483079 1:76146501-76146523 GAGGGAGAAAAGAAGGAGGAGGG - Intronic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910267342 1:85351768-85351790 AAGGGCAGAAAGCAGGATGGTGG + Intronic
911047233 1:93638673-93638695 CATGGTAAACAGCAGGAGGAAGG + Intronic
911210568 1:95134312-95134334 CAGTGAGGAAAGGAGGAGGGTGG + Intronic
911857966 1:102905430-102905452 AAGGAAGAAAAGAAGGAGGGAGG + Intronic
912336407 1:108866852-108866874 CAGGTAGAAAGGCAGGAGGAAGG - Intronic
912717711 1:111993685-111993707 CAGCGAGAAACTCAGGAGGGTGG + Intergenic
912848746 1:113103000-113103022 CTGGCAAAAAAAAAGGAGGGGGG - Intronic
914004238 1:143718303-143718325 CAGGGAAAGAAGCCGGGGAGCGG + Intergenic
914200045 1:145476248-145476270 CGGGGAAAGAAGCCGGAGAGCGG + Intergenic
914479163 1:148049383-148049405 CGGGGAAAGAAGCCGGAGAGCGG + Intergenic
914984211 1:152442321-152442343 CAGAAAAAAAAACAGGAGTGGGG - Intergenic
915075567 1:153306036-153306058 CAGCGACAACAGCAGGATGGTGG + Intronic
915240152 1:154515479-154515501 CAAGGAAGAAGGCAGGAGTGAGG - Intronic
915488727 1:156239890-156239912 CTGGGGAACCAGCAGGAGGGGGG - Intronic
915820730 1:159021245-159021267 CAGGGGAAAGAGTGGGAGGGGGG - Intronic
915901957 1:159854186-159854208 CAGGGATCTAAGCAGGAGGGAGG + Intronic
916135238 1:161646978-161647000 AAGGGTAAAATTCAGGAGGGTGG - Intronic
916324198 1:163538906-163538928 AAGGGAATAAAGAAGGAGGCTGG + Intergenic
916461000 1:165024103-165024125 CAAGGAGAAAAGGAGGAGAGAGG + Intergenic
917079726 1:171245132-171245154 TAGGGGAAAGGGCAGGAGGGAGG + Intergenic
917498450 1:175564239-175564261 CAGGGCAGGCAGCAGGAGGGAGG - Intronic
917564373 1:176196927-176196949 GAGTGAAACCAGCAGGAGGGAGG + Intronic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918079165 1:181192389-181192411 CAGAGAAAAGAGCTGCAGGGAGG + Intergenic
918300838 1:183202387-183202409 CAAGGATAAAAGAAGGAAGGGGG + Intronic
918431779 1:184468401-184468423 GGGGGAAAAAAGGAGGAAGGTGG + Intronic
918490589 1:185077298-185077320 GAGGGAGAGAAGTAGGAGGGAGG - Intronic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
919058868 1:192606057-192606079 GAAAGAAAAAAGAAGGAGGGAGG + Intergenic
919485580 1:198143110-198143132 AAATGACAAAAGCAGGAGGGAGG - Intergenic
919552319 1:199006205-199006227 CAGGGACAAAAGAGGGAGAGGGG + Intergenic
919592635 1:199523605-199523627 CAGGGGAAAGGGTAGGAGGGAGG - Intergenic
919705394 1:200670230-200670252 TCCGGAAAGAAGCAGGAGGGCGG + Intergenic
919721327 1:200839695-200839717 CAGGGAAAAAAGCAGGAGGGAGG + Intronic
919846794 1:201647853-201647875 CAGGTAAAAGAGACGGAGGGAGG - Intronic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920072043 1:203308976-203308998 AAGGGGCAACAGCAGGAGGGTGG - Exonic
920282415 1:204854089-204854111 CAGGCAAAAAGGCTGGTGGGTGG - Intronic
920306014 1:205018579-205018601 CAGGGTAAACAGCAGGGGGTGGG + Exonic
920441624 1:205984750-205984772 CAGGGAAAAAAGGAGAAAGCAGG - Intronic
921382551 1:214539709-214539731 GAGGGAAGAGAGGAGGAGGGAGG + Intronic
922096591 1:222448030-222448052 GAGGGGAAAAGGCTGGAGGGAGG - Intergenic
922109754 1:222545547-222545569 CTGGGAAAAAGGGAGAAGGGAGG + Intronic
922342078 1:224665771-224665793 CTGGGAAAAAGGGAGGGGGGAGG - Intronic
922440498 1:225652536-225652558 AAGGGACAAAAGGCGGAGGGGGG + Intronic
922481889 1:225944999-225945021 CAGGGAATCAAGAAGGTGGGGGG - Intergenic
922698629 1:227744903-227744925 CAGGGATAGGGGCAGGAGGGAGG + Intronic
922722731 1:227906811-227906833 GGAGGAAAAAAGGAGGAGGGAGG - Intergenic
922722760 1:227906914-227906936 GAGGGAAGAAAGTAGGAGGAGGG - Intergenic
922742771 1:228023852-228023874 CAGGGGAGAAGGCAGGCGGGTGG - Intronic
923138582 1:231140775-231140797 CAGGGAAAATAGCAGTAAAGAGG + Intergenic
923309376 1:232721231-232721253 AAGGTCAAAAAGCAGCAGGGAGG + Intergenic
923426034 1:233870624-233870646 CATGAAAAAAAAGAGGAGGGGGG + Intergenic
923460766 1:234207402-234207424 GAGGGAGAAAGGAAGGAGGGAGG - Intronic
924059269 1:240154853-240154875 GAGGGAAGAAAGAAAGAGGGAGG - Intronic
924114544 1:240732225-240732247 CAGAGAAAAAAGAATGAGGCAGG - Intergenic
924202557 1:241675028-241675050 GAAGGAAAGAAGAAGGAGGGAGG - Intronic
1062838331 10:650729-650751 CAGGGAAGTGAGCATGAGGGGGG - Intronic
1063187239 10:3662703-3662725 CAGGAGGAAAACCAGGAGGGTGG + Intergenic
1063798788 10:9546192-9546214 CAGAGAGAAAAGCTGAAGGGTGG + Intergenic
1063842282 10:10085981-10086003 CGGGGAAAAGGGCAGGAGGGAGG - Intergenic
1064502454 10:15989070-15989092 CAGGGTAAACACCAGGAGGCAGG + Intergenic
1064706112 10:18074164-18074186 GAGGGAGAAAAGGAGGAGGCAGG + Intergenic
1064835889 10:19529530-19529552 GACAGAAAAAAACAGGAGGGGGG + Intronic
1064844670 10:19638310-19638332 CAGGGAAAACAAAAGGAGGTGGG + Intronic
1064927274 10:20582691-20582713 CAGAGAAAGTAGGAGGAGGGGGG - Intergenic
1065167069 10:22990922-22990944 CCGGGGAAAAAGGTGGAGGGAGG - Intronic
1065259773 10:23912478-23912500 AAGGGGAAAAAGTAGGAGAGGGG - Intronic
1065263833 10:23954616-23954638 CAGGAAAGAAGGAAGGAGGGAGG + Intronic
1065310785 10:24414463-24414485 CAGGTAACAAAGCAGATGGGAGG + Intronic
1065522906 10:26589173-26589195 CAGGGAAAGAAGAAGGGGTGAGG - Intergenic
1065527926 10:26641192-26641214 CAGGGAAAAAAGAAGGGGTGGGG - Intergenic
1065528830 10:26648444-26648466 CAGGGAAAGAAGAAGGGGTGAGG - Intergenic
1065559275 10:26946059-26946081 CAGGGAAAGAAGAAGGGGTGGGG + Intergenic
1065885375 10:30072146-30072168 AAGGGAAGAAGGGAGGAGGGAGG + Intronic
1065890766 10:30119241-30119263 CAGGGGAAAAGGCAGGAGGGAGG + Intergenic
1066025048 10:31348170-31348192 CTGGGAAAAAAGCAGAAGCAGGG + Intronic
1066179287 10:32944073-32944095 CAGGGGAAAAAGCAAAAGAGAGG + Intronic
1066239861 10:33523152-33523174 CAGGGAAAAAAGTGGGAAGCTGG + Intergenic
1066258402 10:33704295-33704317 GAAGGAGAAAAGCAGGAGGGAGG - Intergenic
1066497878 10:35959878-35959900 AAGGGAAAAAGGAAAGAGGGAGG - Intergenic
1066705259 10:38170897-38170919 GAGGGAGAAAAGAAGGAGGAAGG - Intergenic
1067370999 10:45682402-45682424 AAGGGAAATAAGCAGGAGTAAGG - Intergenic
1067388783 10:45843748-45843770 AAGGGAAATAAGCAGGAGTAAGG + Intronic
1067417283 10:46113209-46113231 AAGGGAAATAAGCAGGAGTAAGG - Intergenic
1067445481 10:46340818-46340840 AAGGGAAATAAGCAGGAGTAAGG - Intergenic
1067502696 10:46820098-46820120 AAGGGAAATAAGCAGGAGTAGGG - Intergenic
1067591893 10:47519915-47519937 TAGGGAAATAAGCAGGAGTAGGG + Intronic
1067639008 10:48027988-48028010 TAGGGAAATAAGCAGGAGTAGGG + Intergenic
1067672203 10:48333666-48333688 CAGGGAAAGAAGAAGGGGTGGGG + Intronic
1067874472 10:49992306-49992328 GAGGGAAATAAGCAGGAGTAGGG - Intronic
1068016236 10:51519480-51519502 CTTGGAAAAAAACATGAGGGGGG + Intronic
1068174002 10:53433469-53433491 AAGGGAAAGAAGAAGGAGGAAGG + Intergenic
1068767310 10:60778310-60778332 CTAGAGAAAAAGCAGGAGGGCGG - Intronic
1069808110 10:71138560-71138582 CGGGGACCACAGCAGGAGGGCGG - Intergenic
1070135999 10:73694152-73694174 AAGGGAAATAAGCAGGAGTAGGG + Intronic
1070711305 10:78685253-78685275 CAGGGATGAAAGCTGGCGGGAGG - Intergenic
1071160071 10:82735035-82735057 AAGGGAAGAAGGAAGGAGGGAGG + Intronic
1071161648 10:82753528-82753550 GAGGAAAGAAAGAAGGAGGGAGG - Intronic
1071265056 10:83957644-83957666 CTGGGAAAGGAGCTGGAGGGAGG + Intergenic
1071474904 10:86017775-86017797 CAGGTAGAAAAGCAGGTGTGGGG + Intronic
1071494050 10:86155677-86155699 CAGTGAAAAAGGCAGGGGAGTGG - Intronic
1071530509 10:86387762-86387784 CTGGAGAAAAACCAGGAGGGTGG - Intergenic
1071845984 10:89521682-89521704 CAAGGAAAAATGAAAGAGGGAGG + Intronic
1071953328 10:90729338-90729360 CAGGGAAAAAAGTGAAAGGGTGG + Intergenic
1072022843 10:91421035-91421057 AGGGGAAAAAAGCCTGAGGGGGG - Intronic
1072224534 10:93356191-93356213 CGGGGGAAAAAGCAGGCAGGTGG - Intronic
1072259285 10:93652987-93653009 TAGGAAAAAAAGCAGGGGGAGGG - Intronic
1072260237 10:93663145-93663167 GAGGCAAAAAAGCAAGAAGGAGG + Exonic
1072415557 10:95243909-95243931 CATAGAGACAAGCAGGAGGGTGG + Intronic
1072436168 10:95416218-95416240 CAGGGAAAAAAGAAAGAGGAGGG + Intronic
1072443361 10:95477123-95477145 AAGGGAAAAGAGGAGGAGGTCGG - Intronic
1073152744 10:101323008-101323030 CAGGGAGAGGAGCAGGAGGAGGG + Intergenic
1073461377 10:103667699-103667721 TAGGGGACAAAGCAGAAGGGTGG - Intronic
1075324528 10:121520180-121520202 GAGGGAAGAAAGGAGGAGTGGGG + Intronic
1075417488 10:122275704-122275726 CAAGGAAAAAAGCACGAGGAGGG - Intronic
1075444051 10:122501522-122501544 CAGGGAAGGAAGTTGGAGGGTGG - Intronic
1075591497 10:123694659-123694681 AAGGAAAAAAGGAAGGAGGGAGG + Intergenic
1075741524 10:124699095-124699117 GAGAGAGAAAAGCAGGTGGGAGG - Intronic
1076199695 10:128548051-128548073 AAGGGAAGAAGGGAGGAGGGAGG + Intergenic
1076252363 10:128994644-128994666 GAGGAAAAAAGGAAGGAGGGAGG + Intergenic
1076371096 10:129954414-129954436 CAGAGAAAAAAAAAGGGGGGGGG - Intronic
1076457556 10:130611280-130611302 CAGGGAGAAGAAGAGGAGGGAGG + Intergenic
1076748998 10:132532348-132532370 CAAGGAAACATGCAGGAGGCTGG + Intergenic
1077183784 11:1227649-1227671 CCGGGAAGAAAGCAGGGGTGTGG - Intronic
1077276038 11:1709041-1709063 CAGGGAAAGAACCAGCAGAGAGG + Intergenic
1077497352 11:2892609-2892631 GAGGGAAGGAAGGAGGAGGGAGG - Intronic
1077563784 11:3283287-3283309 AAGGGAAAAAAGGAGGGAGGGGG - Intergenic
1077569674 11:3329104-3329126 AAGGGAAAAAAGGAGGGAGGGGG - Intergenic
1077655557 11:4016063-4016085 AAGGGAACAAAACTGGAGGGAGG - Intronic
1077718787 11:4606929-4606951 GAGGAAGAAAAGCAGGAGGCAGG - Intronic
1078031154 11:7752623-7752645 CAGAGAAAAAAGCCAGAGGCTGG - Intergenic
1078142528 11:8702537-8702559 CGGGCAAGAAAGCAGAAGGGAGG - Intronic
1078182378 11:9022860-9022882 TAGAGAAAAAAGCGGGAGGTGGG - Intronic
1078328887 11:10402402-10402424 CAGGGAAAAAAAAAGATGGGAGG + Intronic
1079097010 11:17517480-17517502 CAGGGAAAAGAGGAGGAAGCTGG + Intronic
1079252042 11:18793518-18793540 CATGGAGAAAATGAGGAGGGAGG - Intergenic
1079382402 11:19949434-19949456 CAGGGAAATAGGTAGGAGAGAGG - Intronic
1079705972 11:23618964-23618986 TAGGGAAAAAAAATGGAGGGAGG - Intergenic
1079711384 11:23687050-23687072 CAGCAAAAAAAACAAGAGGGTGG + Intergenic
1079744790 11:24111358-24111380 GAGTGAAGAAAGCAGGAGAGAGG + Intergenic
1079977511 11:27110234-27110256 CTGGGAAAAAGGTAGGAGGAGGG - Intronic
1080050224 11:27851919-27851941 GAGGGAAGAAAGAGGGAGGGAGG - Intergenic
1080109325 11:28547754-28547776 CAGGAACAAAGGCAGCAGGGAGG - Intergenic
1080120064 11:28666866-28666888 CAGTGAGCACAGCAGGAGGGAGG + Intergenic
1080387251 11:31817463-31817485 CCGCGAAAAATGCAGGAGGTGGG - Intronic
1080661068 11:34296321-34296343 GAGGGAGACAAGGAGGAGGGTGG + Intronic
1081162902 11:39772706-39772728 CTGAGAAACAAGCAGGAGTGGGG + Intergenic
1081634367 11:44711163-44711185 CAGGGTAGAGAGGAGGAGGGAGG + Intergenic
1081659487 11:44879267-44879289 TAGGGAAAGAAGAAGGAGGAAGG - Intronic
1081738593 11:45422466-45422488 CAGGGCCAAAAGCCTGAGGGTGG + Intergenic
1082757052 11:57087731-57087753 GAGAGCAGAAAGCAGGAGGGAGG + Intergenic
1083234770 11:61344321-61344343 CAGGGAAACAAGTGGAAGGGGGG - Intronic
1083445799 11:62707371-62707393 GAGGGAGGAAAGGAGGAGGGGGG + Exonic
1083511096 11:63209989-63210011 ATGGGAAAAAAGCAGGAGGAAGG + Intronic
1083583511 11:63839798-63839820 CACGGAAGAGCGCAGGAGGGCGG - Intronic
1083842147 11:65310636-65310658 CAGGGAGGAAAGCAGGAGCTTGG + Intergenic
1084344868 11:68540041-68540063 GAGGGAAAATGGAAGGAGGGAGG + Intronic
1084363100 11:68681883-68681905 CAAGAAAGAAAGAAGGAGGGAGG - Intergenic
1084470497 11:69356476-69356498 GAGGGAGGAAAGAAGGAGGGAGG + Intronic
1084793204 11:71488175-71488197 CCGGGAAGAAAGCCTGAGGGAGG - Intronic
1085000466 11:73028721-73028743 CAGGGGAAAAACCTGGTGGGAGG + Intronic
1085096346 11:73763367-73763389 CAGAGACCAAAGCAGCAGGGAGG - Intergenic
1085282514 11:75340454-75340476 CAGGGAGGAAAGGAGCAGGGAGG + Intronic
1085346157 11:75769261-75769283 GAGGGAAACAAGCTGGGGGGCGG - Intronic
1085474138 11:76778948-76778970 CAGGGGAAAAAGCATGGAGGTGG + Intergenic
1085658284 11:78337533-78337555 CAGGGAAAAGAGAAAGAAGGTGG + Intronic
1086000236 11:81974766-81974788 AAGAGAAAAGAGCAAGAGGGAGG - Intergenic
1087583989 11:100094734-100094756 CAGGGAAAGAAGAAGGAGGGAGG + Intronic
1087728128 11:101746447-101746469 AAGGGTGAAAAGGAGGAGGGAGG - Intronic
1087902208 11:103653743-103653765 AAAGGAAAAAAGCAGGGGGAAGG - Intergenic
1088250425 11:107857208-107857230 GAAGGAACAAAGAAGGAGGGAGG + Intronic
1088489656 11:110374482-110374504 CAAAGAAAAAAGGAGGAAGGAGG - Intergenic
1088765599 11:112972929-112972951 CACGGAAAAGAGCCAGAGGGAGG + Intronic
1089012198 11:115140396-115140418 CATGGAAAAAAGAGGAAGGGTGG - Intergenic
1089387844 11:118079680-118079702 CACGGAAAACAGGAGGTGGGAGG - Intronic
1089470521 11:118716706-118716728 AAGGGGAAAAAGCAGGCAGGAGG - Intergenic
1090132475 11:124159151-124159173 CATGTAAAAAAGCAGGATGGCGG - Intergenic
1090145132 11:124313223-124313245 AAGGAAAGAAAGAAGGAGGGAGG + Intergenic
1090806083 11:130203179-130203201 CAGGGCAAAGAGCTGGATGGGGG + Intronic
1091284942 11:134403291-134403313 CAGGGATGAGAGCAGGAGGCTGG + Intronic
1091386062 12:95570-95592 CAGGGAAAAAACATGGAGGTAGG - Intronic
1091652909 12:2323098-2323120 CAGGGAAGGAAGGAGGAAGGCGG - Intronic
1091666250 12:2420454-2420476 CAGGGAGAAAAGCCAGTGGGAGG - Intronic
1092017424 12:5170735-5170757 CAGGGAATCTAGCTGGAGGGAGG + Intergenic
1092160225 12:6311754-6311776 CTTGGGAAAAAGCTGGAGGGAGG - Intronic
1092228527 12:6764443-6764465 CAGGAAAAATAGGAGGAAGGTGG + Intronic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092388511 12:8054477-8054499 GAAAGAAAAAAGCAGGAGAGCGG - Exonic
1092493446 12:8967976-8967998 AAGGGAAGGAAGGAGGAGGGAGG + Intronic
1092818467 12:12331466-12331488 CAGGGAAAAAAGTGGGCCGGAGG + Intronic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093709884 12:22318549-22318571 CAGGGAAAAGAGGGGGAAGGAGG - Intronic
1093853121 12:24065266-24065288 GAGGGAAAATTGCAGGAGAGAGG + Intergenic
1094147782 12:27248522-27248544 CAGGGAATACAGCAGGTGAGCGG + Intronic
1094210576 12:27885756-27885778 CTGGGAACAAAGAAGAAGGGTGG - Intergenic
1094466895 12:30763018-30763040 CGGGGACAGAAGCAGGAGTGAGG + Intergenic
1095097113 12:38154757-38154779 CAGGGAAAAAAGCGGAAGGCCGG + Intergenic
1095619804 12:44238372-44238394 AAGGGAAAATAGAAGGAAGGAGG + Intronic
1095812206 12:46383341-46383363 AAGAGAGAAAAGGAGGAGGGAGG + Intergenic
1095954087 12:47796718-47796740 ATGGGAAGAAAGCAGGAGGCCGG - Intronic
1096124076 12:49106925-49106947 CAGGGACTCTAGCAGGAGGGAGG + Intronic
1096752280 12:53768383-53768405 CAGGGAGTATAGCAGGAGGCTGG + Intergenic
1097352810 12:58567142-58567164 CAGTGAAAAAAAAAGGGGGGGGG - Intronic
1098475903 12:70902729-70902751 CAGGGAGAAGAGTGGGAGGGGGG + Intronic
1098524587 12:71471995-71472017 CAGGGAAAAGGGTAGAAGGGCGG + Intronic
1098833390 12:75390975-75390997 GAGGGAAAAACAAAGGAGGGAGG - Intergenic
1099003790 12:77213422-77213444 CAAGAAAAAAAGTGGGAGGGAGG - Intergenic
1099111258 12:78564459-78564481 CAGGGCAAACACCAGGAGAGTGG + Intergenic
1099712248 12:86242684-86242706 GAGGGAAAAATGGAGGAAGGGGG + Intronic
1099924156 12:88997016-88997038 AAGGGAAAAGAGAGGGAGGGTGG + Intergenic
1100174298 12:92011939-92011961 AAGGAAAAAAGGAAGGAGGGAGG + Intronic
1100274307 12:93058019-93058041 CAGGGTCAAGGGCAGGAGGGAGG + Intergenic
1100404826 12:94263801-94263823 CAGGGATAGAAGCTGCAGGGTGG + Intronic
1100972531 12:100086359-100086381 CTGGGAAAAAAAAAGGGGGGGGG + Intronic
1101443971 12:104724100-104724122 TAGGGAAAAGAGCAGTAGTGTGG + Intronic
1101629470 12:106478989-106479011 AAAGGAATAAAGTAGGAGGGAGG - Intronic
1101820979 12:108184150-108184172 CAGCCATCAAAGCAGGAGGGAGG - Intronic
1101821226 12:108185707-108185729 CAGGGAGGAAGGCAGGAAGGAGG - Intronic
1101842624 12:108339347-108339369 GAGGGAGGAGAGCAGGAGGGAGG + Intergenic
1102052956 12:109876503-109876525 CAGAGAAGAAAGAAAGAGGGAGG + Intronic
1102226233 12:111230179-111230201 GAGGGAAGGAAGCAGGAGAGGGG + Intronic
1102422532 12:112815195-112815217 CAGGGCACAGAGCAGGATGGAGG + Intronic
1102764793 12:115423208-115423230 GAGGAAAAAGAGGAGGAGGGAGG + Intergenic
1102840992 12:116121754-116121776 GAGGTAAAAAAGCAGTAGGTGGG - Intronic
1102990468 12:117311997-117312019 CAGTGGAAAAAGTAGGAGGTAGG + Intronic
1103245768 12:119455888-119455910 AAGGAAAGAAAGAAGGAGGGAGG + Intronic
1103846855 12:123907915-123907937 CAGGGCAACAGCCAGGAGGGAGG - Intronic
1103919360 12:124391368-124391390 CGGGGAAAATGGCAGGTGGGGGG - Intronic
1104092055 12:125525731-125525753 CTGGGAAGGAAGCAGGAGGCAGG - Intronic
1104332136 12:127856818-127856840 CTGGGAAAACACAAGGAGGGAGG + Intergenic
1104410174 12:128551213-128551235 CAGGGGAGGAAGCGGGAGGGGGG - Intronic
1104463197 12:128971387-128971409 AAGGGAGAAAGGAAGGAGGGAGG - Intronic
1104853400 12:131889969-131889991 CAGAGACAAAAGCAGAAGAGAGG + Intergenic
1105221911 13:18338095-18338117 CAGGGAAATAAGGAGGACTGAGG - Intergenic
1106033490 13:26023472-26023494 CAGTGAAAAATGCGGGGGGGTGG + Exonic
1106313674 13:28575572-28575594 TAGGGAAAGAAGCCAGAGGGAGG + Intergenic
1106882876 13:34150864-34150886 GAGGCAAAAATGAAGGAGGGGGG - Intergenic
1107336550 13:39361913-39361935 GAGGGAAAAGGGCAGGAGGGAGG + Intronic
1107829191 13:44359415-44359437 GAGGGTGAAAAGTAGGAGGGAGG - Intergenic
1107917641 13:45168900-45168922 GAGGGAAGGAAGGAGGAGGGAGG - Intronic
1107982220 13:45744614-45744636 CAGGGAGGAAAGAAGGAAGGAGG + Intergenic
1108224806 13:48277554-48277576 CTGGAAAGAAAGAAGGAGGGAGG + Intergenic
1108321565 13:49295454-49295476 CAAGGACAAAAGGTGGAGGGAGG + Intergenic
1108577120 13:51800104-51800126 TAGGGAATAAAGGAGGAGGATGG + Intronic
1108734035 13:53263830-53263852 CAGGTCAGAAAGCAGGAGGGTGG - Intergenic
1108971117 13:56378462-56378484 GAGGGAAGAAGGGAGGAGGGAGG + Intergenic
1109642850 13:65213024-65213046 CAGGAAAAAAGGAAGGAGGGAGG + Intergenic
1109709947 13:66146533-66146555 CAGAGCAAAAAGGAGGAGGACGG + Intergenic
1111000261 13:82169736-82169758 CAGGGAAAAAGGGAGGAAGTAGG + Intergenic
1111020634 13:82444780-82444802 CAAGGAAAAAATCAGGAGGAGGG - Intergenic
1111372098 13:87332845-87332867 CATGAAAACAACCAGGAGGGAGG - Intergenic
1112676595 13:101709067-101709089 AAGGAAGAAAAGCAGGAGGCCGG + Intronic
1113074401 13:106453544-106453566 CGGGGAGAATAGCATGAGGGTGG + Intergenic
1113709711 13:112455224-112455246 CAGGGAGAGAAGCTGGATGGAGG - Intergenic
1113975668 13:114225627-114225649 GAGGGAGAAGAGAAGGAGGGAGG + Intergenic
1114325901 14:21588362-21588384 CAGCGACAAAGGCAGGAGGTGGG + Intergenic
1114465922 14:22922671-22922693 AAGGGAAGAAAGCAGGAGGAAGG + Intronic
1114590918 14:23864084-23864106 CTGGGAAAAACACAGGTGGGTGG - Intergenic
1114706970 14:24737393-24737415 CATGAAAGAAACCAGGAGGGAGG - Intergenic
1114709667 14:24765746-24765768 GAGGGAAAGAAGGAGGAGTGGGG + Intergenic
1115103695 14:29734334-29734356 CATATAAAAAAGCAGGAGGCTGG - Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117424666 14:55580965-55580987 CACGGAAAGCAGCATGAGGGGGG + Intronic
1117644490 14:57837321-57837343 CAGCGAAAAGAGCAGAAGGGAGG + Intronic
1117845125 14:59903737-59903759 GAGGGAAAAAAGGAGGGGAGGGG - Intergenic
1118361587 14:65061844-65061866 AAGGGAAAAGAGCTGGAGGTGGG + Exonic
1118676310 14:68188351-68188373 AAGGGGAGAAAGGAGGAGGGGGG - Intronic
1119184772 14:72632620-72632642 GAAGGAAAGAAGCAGGAGGAAGG + Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119652316 14:76392603-76392625 TGGGGAAAACATCAGGAGGGTGG - Intronic
1119847289 14:77839940-77839962 AAAGGAAAAAAGAAGTAGGGAGG + Intronic
1119883893 14:78124095-78124117 AAGGGAACAATGGAGGAGGGAGG - Intergenic
1119892738 14:78195064-78195086 CAGGGAAAAAAAAGGGTGGGGGG - Intergenic
1119893027 14:78197332-78197354 CAGAGAAGCAAGAAGGAGGGAGG - Intergenic
1120421918 14:84298317-84298339 CAGAGGAAAAGGTAGGAGGGAGG + Intergenic
1120428780 14:84387184-84387206 GAGGGAAGAAACGAGGAGGGAGG - Intergenic
1120720039 14:87880823-87880845 AAGGTAACACAGCAGGAGGGAGG + Intronic
1120791933 14:88592163-88592185 CAAGGAAAAAAGCAGGAAAGAGG - Intronic
1121019142 14:90568298-90568320 TAGGGAGCAAAGCAGGAAGGAGG + Intronic
1121032758 14:90673430-90673452 AAGAGAAAAAAGAAGGAGCGCGG + Intronic
1121047050 14:90795966-90795988 CAGGGAACCAGGCAGGAGAGGGG + Intronic
1121085102 14:91139892-91139914 AAGGGGAGAAAGCAGGATGGAGG + Intronic
1121734632 14:96209505-96209527 AAGGGAAAAAAGCAGGCAGTAGG + Intronic
1121788263 14:96679477-96679499 CTGTGAAAAAATCAGGAAGGAGG - Intergenic
1122141198 14:99664101-99664123 CAAGGACAAAAGCAGGAGGCTGG - Intronic
1122158359 14:99764701-99764723 CAGGCACAGAAGCAGCAGGGTGG + Intronic
1122253889 14:100462910-100462932 AAGGGAAAAAGGAAGGAGCGGGG - Intronic
1123112451 14:105879733-105879755 CAGGAAGAAAGGAAGGAGGGAGG + Intergenic
1123194896 14:106606687-106606709 CAGGTGAAAAGGGAGGAGGGAGG + Intergenic
1123197182 14:106627816-106627838 GAGGTGAAAAAGGAGGAGGGAGG + Intergenic
1123198526 14:106639692-106639714 GAGGTGAAAAAGGAGGAGGGAGG + Intergenic
1123578369 15:21695059-21695081 GAGGGAAATCAGCAGGAGGTAGG + Intergenic
1123614994 15:22137541-22137563 GAGGGAAATCAGCAGGAGGTAGG + Intergenic
1123715072 15:23022258-23022280 CAGGGCAAAATGGAGGACGGTGG + Intronic
1123875644 15:24621524-24621546 CAGAGAACAAAGCTGGAGGCTGG - Intergenic
1124211996 15:27771075-27771097 GAGGGAGAAAAGAGGGAGGGAGG - Intronic
1125228478 15:37424544-37424566 CAGGGGAAAGGGCAGGAGAGGGG - Intergenic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125431532 15:39599527-39599549 GAGAGAAAGAAGGAGGAGGGAGG - Intergenic
1125834775 15:42739435-42739457 TAGGGAAAAAAGAGGGAGGGGGG - Exonic
1125882918 15:43209223-43209245 CAGGGAACAACCCAGGAGGCAGG + Intronic
1126081928 15:44971825-44971847 AAGGGAAAAAAGGAGGGGGGGGG - Intronic
1127223211 15:56902106-56902128 GAAGGAATAAAGAAGGAGGGAGG + Intronic
1127226459 15:56935622-56935644 CAGGGAAAAGGGTGGGAGGGCGG - Intronic
1127405298 15:58638228-58638250 AAGGAAAAAAAGCAGAGGGGGGG + Intronic
1127559060 15:60117935-60117957 CAGGGAAAAAAGGTTGAAGGAGG + Intergenic
1127800835 15:62476208-62476230 CAGGTGACAAAGCAGGAGGAGGG - Intronic
1127849155 15:62897906-62897928 TGGGGAAGAAAGCAGAAGGGAGG + Intergenic
1127927353 15:63559913-63559935 ATGGGAAAACAGCAGGAAGGCGG + Exonic
1128358297 15:66943546-66943568 AAGGGAAAGAAGAGGGAGGGAGG - Intergenic
1128895118 15:71366036-71366058 CTGGGACACAAGTAGGAGGGAGG - Intronic
1129119526 15:73387532-73387554 GAGGGAAAAAAGAGGGAGTGAGG + Intergenic
1129239479 15:74242978-74243000 CAGGGAAGACAGCAGGGAGGAGG - Intronic
1129296278 15:74602086-74602108 CAGGGAAAGCAGCAGCAGGAGGG - Intronic
1129614674 15:77089063-77089085 CATGGAATAAATGAGGAGGGAGG - Intergenic
1130146530 15:81278516-81278538 CAGGGAGACAAGGAGGAAGGAGG + Intronic
1130330523 15:82918656-82918678 CAGGGAGAACAGCAGCAGGGAGG - Intronic
1130698509 15:86155489-86155511 CAGATAAAAAGTCAGGAGGGTGG + Intronic
1130830996 15:87599421-87599443 CAAGGATTAAGGCAGGAGGGAGG - Intergenic
1130977628 15:88789480-88789502 CAAGGAATAAAGCTGGAAGGAGG + Intergenic
1130987539 15:88854605-88854627 CAGGGAGAAAGGAAGGAGGGAGG - Intronic
1131265234 15:90911627-90911649 CAGGGCCACAAGCAGGAGGGTGG - Intronic
1131653146 15:94423988-94424010 CTGGGGACAAAGCAGGAAGGAGG - Intronic
1132016216 15:98319766-98319788 TATGGAAAAGAGGAGGAGGGAGG + Intergenic
1132022295 15:98373138-98373160 CAGGGATAAAGGAAGGAGGGTGG + Intergenic
1202987239 15_KI270727v1_random:429304-429326 GAGGGAAATCAGCAGGAGGTAGG + Intergenic
1133569621 16:7027916-7027938 AAGGGAAAAGAGAAGGAAGGAGG + Intronic
1133698838 16:8290146-8290168 CTGGTAGAAAAGGAGGAGGGTGG - Intergenic
1134187860 16:12098618-12098640 CAGGCAAAAGAGGAGGAGAGGGG - Intronic
1134234655 16:12455824-12455846 CAGGAAAGAAGGAAGGAGGGAGG - Intronic
1134321236 16:13166308-13166330 CAGGCAAAAAAGCAAGAGAAAGG - Intronic
1134755150 16:16660465-16660487 CAGGCAAGAAAGCAGGTGCGGGG - Intergenic
1134776506 16:16858295-16858317 CAGGGAAGAAACTGGGAGGGTGG - Intergenic
1134990913 16:18698708-18698730 CAGGCAAGAAAGCAGGTGCGGGG + Intergenic
1135200192 16:20430644-20430666 TAGGGAACAAAGAAGAAGGGAGG + Intronic
1135218498 16:20592965-20592987 TAGGGAACAAAGAAGAAGGGAGG - Intergenic
1135686719 16:24503702-24503724 CAGAGATAAATGAAGGAGGGAGG + Intergenic
1135743686 16:24998088-24998110 CAGGGAAGAAGCCAGGAGCGAGG + Intronic
1135938758 16:26803079-26803101 AAGGAAGAAAAGAAGGAGGGAGG + Intergenic
1136012298 16:27371793-27371815 CAGGGAAGCAGGCAGGAGGTGGG - Intergenic
1136030015 16:27495938-27495960 CAGGGAACCAACAAGGAGGGTGG + Intronic
1136474881 16:30506678-30506700 CAGGGAAAGATGGAGGAGGGAGG - Intronic
1137442862 16:48511081-48511103 CAGGAAACAAAGCAGGATGGTGG - Intergenic
1137465284 16:48702867-48702889 CAAGGAAAGAAGGTGGAGGGAGG - Intergenic
1137466426 16:48713971-48713993 CAGAGAAAGAAGGGGGAGGGAGG - Intergenic
1137495041 16:48963028-48963050 CAGGGAGGAAGGAAGGAGGGAGG + Intergenic
1137552177 16:49445266-49445288 GAGGGAAAAAAGAGGGAGAGAGG - Intergenic
1137911921 16:52386151-52386173 CACGGAAAAGAGCAGGCTGGTGG + Intergenic
1138071633 16:53998220-53998242 AAGGGCAAAAAGCAGTAGTGAGG + Intronic
1138299266 16:55912630-55912652 CAGGGAAAAGACCAGGAGGAGGG + Intronic
1138378367 16:56582667-56582689 CAAGGAAAAACGAGGGAGGGAGG + Intergenic
1138446931 16:57070440-57070462 CAGGGGACAGAGCAGGAGAGGGG + Intronic
1138552720 16:57756271-57756293 CAAGGAACAAAGGAGGAGAGGGG - Intronic
1138579385 16:57930494-57930516 AAAGGAAGAAAGCAGGAGAGGGG + Intronic
1138961595 16:62035626-62035648 CAGGGAAAAAAGGAGGCGAGGGG - Intronic
1139091154 16:63649648-63649670 CATGGCAAAAGGCAGAAGGGCGG + Intergenic
1140250136 16:73288106-73288128 CAGGGAGCCAAGGAGGAGGGTGG + Intergenic
1140257516 16:73349758-73349780 GAGGGAAAAAAGAGGGAGGAAGG - Intergenic
1140257777 16:73351518-73351540 CTGGGAGAAAAGCAGCTGGGGGG - Intergenic
1140754381 16:78054468-78054490 AAGGGAAAAAAGCAGCATTGTGG - Intronic
1140958886 16:79893759-79893781 CAGGGTAAAAAGGATGAGGCAGG + Intergenic
1141023893 16:80525365-80525387 GATGGCAAAAAACAGGAGGGAGG - Intergenic
1141039760 16:80663052-80663074 AGGGGAAAAAAGCAAGAGGCTGG + Intronic
1141225982 16:82115250-82115272 CAGGGGAAAAGGTGGGAGGGAGG - Intergenic
1141411661 16:83838350-83838372 AAGGGAAAAAGGAAGGAAGGAGG + Intergenic
1141427141 16:83951884-83951906 CAGGGAGAGAAGGAGGAAGGAGG - Intronic
1141464964 16:84199268-84199290 CTGGGAAAACGGCAGGCGGGAGG + Intergenic
1142041237 16:87895708-87895730 CAGAGACAGAAGCAGCAGGGCGG - Intronic
1142312938 16:89324350-89324372 GAGGGAAAAAGCCAGGAGGGCGG + Intronic
1142958249 17:3535472-3535494 GAGGGAAGAAGGGAGGAGGGGGG - Intronic
1143021308 17:3918272-3918294 AAGGAAAAAAGGAAGGAGGGAGG + Intergenic
1143040692 17:4034035-4034057 CAGGCTAAAGAGCAGGTGGGTGG + Exonic
1143376868 17:6472172-6472194 CAGGGAGAACAGCAGGAGCGAGG - Intronic
1143412012 17:6714611-6714633 AAGGGAAAAGGACAGGAGGGAGG - Intergenic
1143417029 17:6757834-6757856 CATGGGAAGGAGCAGGAGGGAGG - Intronic
1143771437 17:9171550-9171572 CATGGAGGAAAGCAGCAGGGTGG + Intronic
1145102971 17:20092047-20092069 GAGGGAGAAAAGGAGGAGAGAGG - Intronic
1145710081 17:26963364-26963386 ATGGGAGAAAAGAAGGAGGGCGG + Intergenic
1145941560 17:28745615-28745637 CAGGGAAGAAGACAGGATGGGGG - Intronic
1146659698 17:34657536-34657558 CAGGGCAAAGGGCAGAAGGGAGG - Intergenic
1146700059 17:34949494-34949516 GAGGGAAGAAGGAAGGAGGGAGG + Intronic
1146821499 17:35986508-35986530 CAGGGAAATAAGCAGGAGTGAGG - Intronic
1146943087 17:36857337-36857359 CAGGGAGACAAGGCGGAGGGAGG - Intergenic
1146961263 17:36982031-36982053 CAGAGAGAAAAGCAGAATGGTGG - Intronic
1146964540 17:37013908-37013930 AAGGGGAAAAAGTAGAAGGGAGG - Intronic
1146979508 17:37146707-37146729 AAGGGAGAGAAGAAGGAGGGGGG + Intronic
1147050948 17:37794469-37794491 CAAGGAAAAAAGCAGCCTGGAGG + Intergenic
1147667966 17:42160545-42160567 CTGGGAAAAAGGCAGGATGAGGG + Intronic
1148166464 17:45487372-45487394 CAGGGAAAGATGCAGGAGTTGGG - Intronic
1148443120 17:47721910-47721932 CAAGGTGAAAAGCAAGAGGGAGG + Intergenic
1149424935 17:56545939-56545961 AAGGGAAGGAGGCAGGAGGGAGG + Intergenic
1149923398 17:60679279-60679301 AAGGGAAAAAAGGAGGAAGTAGG - Intronic
1149985728 17:61345491-61345513 CATGGAAAAATGAAGGAGGGAGG + Intronic
1150138578 17:62709987-62710009 CAGAGCAAAAAGCAGCAGGAGGG - Intronic
1150197619 17:63317313-63317335 CAGGGAAATGACAAGGAGGGGGG - Intronic
1150226725 17:63528427-63528449 CAGGGAGGAAAGCGAGAGGGAGG + Intronic
1150269008 17:63850435-63850457 CAAGAAAGAAAGAAGGAGGGAGG + Intergenic
1150397633 17:64833772-64833794 CAGGGAAAGATGCAGGAGTTGGG - Intergenic
1150502032 17:65660286-65660308 GAGAGAAAAGAGAAGGAGGGAGG - Intronic
1151362952 17:73599573-73599595 GAGGGAAAAGAGGAGGAGAGAGG + Intronic
1151458942 17:74243382-74243404 CAGGATAAAGAGCAGGAGGTAGG - Exonic
1151757683 17:76083912-76083934 CAAGGGAAAAAGGAGAAGGGTGG - Intronic
1151888106 17:76935127-76935149 AAGGGAATGAAGCAGGAAGGAGG + Intronic
1152042745 17:77915072-77915094 CAGAGAAAAGGGCAGGAGGATGG - Intergenic
1152103438 17:78315767-78315789 CAGGGAAAATGGAAGGCGGGCGG + Intergenic
1152106889 17:78335437-78335459 CAGAGAAGAGGGCAGGAGGGAGG - Intergenic
1152351425 17:79785871-79785893 CTGGGACACAGGCAGGAGGGAGG - Exonic
1152479349 17:80539694-80539716 CAGGGAGAAATGCAGGGGGTGGG - Intergenic
1152551652 17:81033375-81033397 CAGGGAACACAGCAGGAAGCTGG + Intergenic
1152913083 17:83016628-83016650 GAGGGACAGAAGAAGGAGGGAGG + Intronic
1153800122 18:8661347-8661369 CAAGAAAAAGAGCAGGAGAGAGG + Intergenic
1154091847 18:11371618-11371640 AAGGAAGAAAAGCAAGAGGGAGG - Intergenic
1154139316 18:11809266-11809288 AAAGGAAGAAAGCAGGAGGCTGG + Intronic
1154191364 18:12233553-12233575 CAGAGAAAATAGCAGGCGTGTGG - Intergenic
1155680852 18:28483698-28483720 CAGGGAAAGAAGTGGGAGGCAGG + Intergenic
1156261806 18:35451468-35451490 GAGGGAAAAGGGTAGGAGGGAGG + Intronic
1156507618 18:37608413-37608435 CTGTGATAAAAGTAGGAGGGAGG - Intergenic
1156925679 18:42575088-42575110 CAAGGAAATAAGCAGAAGGCTGG + Intergenic
1157206746 18:45707177-45707199 AACGCAAAAAAGCAGGTGGGTGG + Intergenic
1157327352 18:46678687-46678709 CAGGGAGAAAGGAAGGAGGGAGG + Intronic
1157339228 18:46764633-46764655 CTGGGACAATAGCAGGAGAGTGG + Intergenic
1157415678 18:47500774-47500796 CAGGGAAACAAGGATGAAGGGGG + Intergenic
1158103765 18:53861333-53861355 GAGGGAGGAAAGAAGGAGGGAGG + Intergenic
1158103772 18:53861352-53861374 GAGGGAGGAAAGGAGGAGGGAGG + Intergenic
1158155726 18:54423378-54423400 AAGGGAAAAAGGAGGGAGGGAGG + Intergenic
1158806793 18:60983387-60983409 CAGGGAAAAAAGGAAGAGATTGG + Intergenic
1159159833 18:64629537-64629559 GGGGGAAAAAACAAGGAGGGAGG - Intergenic
1159950757 18:74481182-74481204 AATGGAAGAAAGCAGGAGGCAGG - Intergenic
1159951861 18:74489946-74489968 GAGGGAACAAGGGAGGAGGGAGG + Intergenic
1160024314 18:75205792-75205814 CAAGAAAAAAAGCGGGGGGGAGG + Intronic
1160851361 19:1194514-1194536 CAGGGCAAGAGGCAGGAGGAGGG - Intronic
1161058310 19:2201413-2201435 CAGGGAAGACAGCAGGAGCGAGG - Intronic
1161404352 19:4083302-4083324 CAGGGGAGACAGCAGGATGGTGG + Intergenic
1161715910 19:5876346-5876368 CTGGGAATTAAGCAGGAGGCAGG - Intronic
1162094504 19:8302556-8302578 CCAGGACAAAAGGAGGAGGGTGG + Exonic
1162096383 19:8312259-8312281 CAAGAAAGGAAGCAGGAGGGTGG + Intronic
1162115856 19:8428993-8429015 TAGGGAGAAAAGTGGGAGGGAGG + Intronic
1162638192 19:11986841-11986863 AAGGGAAATAAGCAGGGAGGAGG + Intergenic
1162669723 19:12245882-12245904 CAGGAAAACAGGCAGGAGGCCGG - Intronic
1162985830 19:14268983-14269005 CAGGGGAAAAAGTAGGGTGGGGG - Intergenic
1163004756 19:14390120-14390142 GAGGGAAAGAAGAGGGAGGGAGG + Intronic
1163189771 19:15669246-15669268 CAGGGACAAAAGAAGAAGGAAGG + Intergenic
1163297726 19:16422957-16422979 CGGGGAAAAAAAAAGGGGGGGGG + Intronic
1163580343 19:18135059-18135081 CAGGGAGAGAAGCAGGAAGAGGG + Intronic
1163741821 19:19018971-19018993 CAGTGAGAAGAGCATGAGGGTGG - Intronic
1164011184 19:21204711-21204733 ATGGGATAAAAGCAGGAGGAAGG - Intergenic
1164015836 19:21255250-21255272 ATGGGATAAAAGCAGGAGGAAGG + Intronic
1164335596 19:24316314-24316336 CAGGAAAAAAAGGAGAAGGAAGG + Intergenic
1164510470 19:28892657-28892679 CATGGTCAAAGGCAGGAGGGTGG - Intergenic
1164709269 19:30343864-30343886 GAGGGAAAACAGCAAGAGGTTGG + Intronic
1164771941 19:30816247-30816269 AAGGGAAGAAAGAAGGAAGGAGG - Intergenic
1166695418 19:44848917-44848939 CAGGGAAGAAAGCTGGGGGAGGG - Intronic
1166730846 19:45058190-45058212 GAGGGAAGAGAGCAGGAGAGAGG - Intronic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167223666 19:48221032-48221054 GAGGGAAAAAAGAAAGAGGAAGG + Intronic
1167303615 19:48694600-48694622 CAAGGAAAAAAGAAACAGGGTGG - Intergenic
1167428622 19:49442188-49442210 CAGGGAGAGAAGCAACAGGGAGG - Intronic
1167504376 19:49863320-49863342 CGTGTAAAACAGCAGGAGGGAGG - Intronic
1167839848 19:52106778-52106800 AAGAGAAAATAGCAGGAGGAAGG - Intergenic
1168293529 19:55368574-55368596 CAGGGAAAAAAGCTGTGAGGTGG + Intronic
1168569424 19:57453133-57453155 AAAAGAAAAGAGCAGGAGGGAGG - Intronic
925034226 2:673707-673729 CAGGGAAAGAACCAGAGGGGAGG + Intronic
925287695 2:2726691-2726713 TGGGGAAAAAAGCAAGAGGAGGG - Intergenic
925575633 2:5357189-5357211 CATGGAAAATAGAGGGAGGGGGG + Intergenic
925749494 2:7074821-7074843 AAGGGAAGAAAGAAGGAGGGGGG + Intergenic
925976995 2:9148666-9148688 CAGGGAAACAGAAAGGAGGGAGG - Intergenic
926107912 2:10163741-10163763 CAGGCAGAAAACCAGGAGAGGGG - Intronic
927518370 2:23685178-23685200 CAGGGCAGAGGGCAGGAGGGAGG - Intronic
928229096 2:29480673-29480695 CAGGGAGGAAAGCAGAAGTGGGG + Intronic
928254152 2:29707430-29707452 CAGGGAAAACAGAACAAGGGAGG + Intronic
928501711 2:31903405-31903427 CACAGAAAAAAACAGGGGGGTGG + Intronic
929171151 2:38934534-38934556 AAGGGAGAAAAGGGGGAGGGAGG - Intronic
929910142 2:46082782-46082804 CAGGGAAGAAAGCTGCAGAGAGG + Intronic
931171925 2:59812800-59812822 AAGGGTCTAAAGCAGGAGGGTGG - Intergenic
931622903 2:64229046-64229068 CAGGAAAAAAACCATGAGGTAGG - Intergenic
931757695 2:65388659-65388681 AAGGACCAAAAGCAGGAGGGGGG + Intronic
932168282 2:69528650-69528672 GAGGGTAAAAAGAAGGAAGGAGG + Intronic
932496646 2:72148850-72148872 GAGGGGGAAAAGCAGGAGGCAGG + Intergenic
933366017 2:81355069-81355091 AAGGCAAATAAGAAGGAGGGAGG + Intergenic
933888129 2:86739412-86739434 CAGGAAAAAAAGGAGGAGAAGGG - Intronic
933919487 2:87030320-87030342 CAGGTAAATCAGCACGAGGGAGG + Intergenic
933922049 2:87057294-87057316 CAGGAAAAAAAGGAGGAGAAGGG + Intergenic
934003507 2:87739587-87739609 CAGGTAAATCAGCACGAGGGAGG - Intergenic
934182120 2:89634298-89634320 CAGGGAAATAAGGAGGACTGAGG + Intergenic
934292419 2:91708506-91708528 CAGGGAAATAAGGAGGACTGAGG + Intergenic
934579400 2:95426563-95426585 AAGGGACAAGAGCAGGAAGGAGG - Intergenic
934600043 2:95650161-95650183 AAGGGACAAGAGCAGGAAGGAGG + Intergenic
935433017 2:102998284-102998306 CAGGGACAAAAGGAGGAATGAGG + Intergenic
935616422 2:105087784-105087806 AAGGAAAAAAGGCAGGAGGGAGG - Intronic
935712830 2:105914237-105914259 CAGGGAAATGAGCAGGGAGGCGG - Intergenic
935787238 2:106560333-106560355 CTGGGAAAAAAGAGGGAGGGAGG - Intergenic
936527977 2:113255083-113255105 GAAGGAAAAAAGAAGGAAGGAGG + Intronic
936533388 2:113292165-113292187 AAGGGACAAGAGCAGGAAGGAGG + Intergenic
937264484 2:120607292-120607314 CAGGGCATAGAGCAGGAGGATGG + Intergenic
937372428 2:121309313-121309335 CAGGAAAGAAGGAAGGAGGGAGG + Intergenic
937768812 2:125694930-125694952 CAGGGAGAGAAGAAGGAGTGAGG + Intergenic
938293820 2:130164331-130164353 CAGGGTCAGAAGCAGGAGGTGGG + Intronic
938451240 2:131423384-131423406 TGGGAAAAAAATCAGGAGGGAGG + Intergenic
938462724 2:131508631-131508653 CAGGGTCAGAAGCAGGAGGTGGG - Intergenic
939171422 2:138700736-138700758 CCAAGAAACAAGCAGGAGGGAGG - Intronic
940123410 2:150294295-150294317 CAGAGAGAAAAGCAGGGGAGAGG - Intergenic
940638796 2:156327832-156327854 CAGGGTAAGAAGCTGGCGGGGGG - Exonic
940677193 2:156738827-156738849 CAGGGAAATGAGCAGCTGGGTGG + Intergenic
940971510 2:159901607-159901629 CAGTGGAAAAAGCAGGAGTTAGG + Intronic
941592279 2:167434712-167434734 AAGGGAAAAAATAAGGGGGGGGG - Intergenic
942211752 2:173678231-173678253 GAGAGAAAGAAGCAAGAGGGAGG + Intergenic
944197638 2:197072101-197072123 AAAGGAAGAAAGGAGGAGGGAGG + Intronic
944832728 2:203549113-203549135 GAGGGAAGAAGGAAGGAGGGAGG - Intergenic
944993065 2:205260199-205260221 CAGGTAAAAAAGCAGCACAGTGG + Intronic
945163625 2:206919299-206919321 AAGGGAAAAAAGGAAGAGTGTGG + Intergenic
945324996 2:208471830-208471852 TTGTGAAAGAAGCAGGAGGGGGG + Intronic
945983770 2:216338547-216338569 GAGGGACAAAAGGAGGAGGTAGG - Intronic
946792823 2:223318834-223318856 AGGGGATAAAAGCAGGAGGGTGG - Intergenic
947282407 2:228469976-228469998 CAGGGCAGAAAGCAAGAGGTGGG - Intergenic
947389486 2:229624268-229624290 AAGAGAAAAAAGCAGGAAGATGG + Intronic
947699394 2:232219796-232219818 CAAGGATACAGGCAGGAGGGAGG - Intronic
947785896 2:232819803-232819825 TAAGGAAAAAAGATGGAGGGTGG - Intronic
948117940 2:235507515-235507537 AAGGGAAGAAACCAGGAGGATGG - Intronic
948289921 2:236817265-236817287 AAGGGAGAAAGGAAGGAGGGAGG - Intergenic
948342869 2:237269230-237269252 CAGGGAAAAGAGCAGAGGTGTGG - Intergenic
948386203 2:237582456-237582478 CAGGGAAAAAATCCAGACGGAGG + Intronic
948462515 2:238137200-238137222 CAGGGGAAAGAGCAGGAGCAGGG + Intergenic
948570869 2:238916429-238916451 GAGGGAAAGAAGGAGGAGGGAGG + Intergenic
948583224 2:239002450-239002472 CAGGGAGAGAAGGAGGAGTGTGG - Intergenic
948703074 2:239772855-239772877 GAGGGAGGAAAGGAGGAGGGAGG - Intronic
948800172 2:240429916-240429938 CAGGGAGGGAAGGAGGAGGGGGG - Intergenic
948947642 2:241229167-241229189 AAGGGAAACTGGCAGGAGGGAGG + Exonic
1168785030 20:531199-531221 AAAGAAATAAAGCAGGAGGGAGG + Intronic
1168900312 20:1358306-1358328 CATGGGAAGAAGGAGGAGGGAGG + Intronic
1168966640 20:1902634-1902656 TGGGGAGAAAAGCAGGAGGAGGG + Intronic
1168975606 20:1963223-1963245 GACGGAGAAAAGAAGGAGGGAGG + Intergenic
1169143765 20:3239655-3239677 CCGGGATAAATGCAGGAGGCGGG - Intergenic
1169541628 20:6606108-6606130 AAGGGAAAAGGGAAGGAGGGCGG - Intergenic
1169719381 20:8657109-8657131 CAGAGAAAAAACAGGGAGGGAGG + Intronic
1169878989 20:10326953-10326975 AAGGGAAAAAAGCAGGTCAGTGG + Intergenic
1169914740 20:10673878-10673900 CATGGAAAAAGGGGGGAGGGAGG + Exonic
1170034721 20:11978429-11978451 AAAGGAAAAAGGCGGGAGGGAGG - Intergenic
1170146835 20:13184725-13184747 CATGGCAAAAAGCAGAAGTGTGG - Intergenic
1170215453 20:13886133-13886155 CAGGGAACAAAACAGGAGTAGGG + Intronic
1170758088 20:19222743-19222765 GAGGGAAGGAAGAAGGAGGGAGG - Intronic
1170915885 20:20625037-20625059 CAGGCAGAAAAGCAAGAGGGAGG - Intronic
1172204459 20:33153043-33153065 AAGGGGAGAAAGCAGGAGTGGGG - Intergenic
1172221515 20:33277464-33277486 CAGGGGCAAAGGAAGGAGGGTGG - Intronic
1172335708 20:34113642-34113664 AAAGAAAGAAAGCAGGAGGGAGG + Intergenic
1172387091 20:34541580-34541602 GAGGGAAAAAAACAAGAGTGTGG - Intergenic
1172452586 20:35038028-35038050 CAGAGAAAAAAGCAGAATGGTGG + Intronic
1172787670 20:37479911-37479933 CAGAGAGGAAAGCAGCAGGGGGG - Intergenic
1172946975 20:38697247-38697269 CAGGAAAAGAAGCAGGAGATGGG + Intergenic
1172958987 20:38784129-38784151 AAGGGAAAAAAGCAGAAGCTTGG - Intergenic
1172974475 20:38895844-38895866 GAGGGAAGAAAGAAGGAAGGAGG - Intronic
1172974483 20:38895871-38895893 GAGGGAAGAAAGAAGGAAGGAGG - Intronic
1172974491 20:38895898-38895920 GAGGGAAGAAAGAAGGAAGGAGG - Intronic
1172974499 20:38895925-38895947 GAGGGAAGAAAGAAGGAAGGAGG - Intronic
1173047987 20:39530987-39531009 AAGGGAAAAAGGATGGAGGGAGG - Intergenic
1173112831 20:40209957-40209979 AAGGGAAGAAAGGAGGAGGCAGG + Intergenic
1173144213 20:40510854-40510876 CAGGGAGGAAAGAAGGAGGAAGG + Intergenic
1173179795 20:40797178-40797200 CAGGGCTAAGAGCATGAGGGAGG + Intergenic
1173459595 20:43232601-43232623 TAAGGAGAAAAGCAAGAGGGTGG + Intergenic
1174095989 20:48089832-48089854 CATGGAAAGAATCAGGCGGGAGG + Intergenic
1174104919 20:48155287-48155309 CAGGGAAAACAAGAAGAGGGGGG - Intergenic
1174187530 20:48717223-48717245 AAGAGAAAAAGGCAGGAGGGTGG + Intronic
1174265129 20:49325767-49325789 GAGGGCAAGAAGGAGGAGGGAGG - Intergenic
1174469351 20:50744648-50744670 GAGGGTGAAAAGCAGGAGGGAGG - Intronic
1174477246 20:50804333-50804355 GAGTGAAAAAAGCATGAGGCCGG - Intronic
1174589795 20:51635838-51635860 GAGGGAAAAAGGAAGGAAGGAGG + Intronic
1175059670 20:56230508-56230530 CAGGGAAGAAAGAGGGAGAGAGG + Intergenic
1175117316 20:56691652-56691674 CACCGAGAGAAGCAGGAGGGAGG + Intergenic
1175243766 20:57568795-57568817 AAGGAAAAAGGGCAGGAGGGAGG - Intergenic
1175293662 20:57894617-57894639 GAAGGAAGAAAGAAGGAGGGAGG + Intergenic
1175293681 20:57894689-57894711 GAAGGAAGAAAGAAGGAGGGAGG + Intergenic
1175333602 20:58180803-58180825 CACAGAAAGAAGCAGGAGGGAGG - Intergenic
1175642515 20:60642877-60642899 CAGGGAAAGAAGCAGGCAGGAGG - Intergenic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1176205551 20:63886200-63886222 CAGGGAACAAAGCAGCAGCGTGG + Intronic
1176730348 21:10488935-10488957 CAGGGAAATAAGGAGGACTGAGG - Intergenic
1176935601 21:14862809-14862831 AAGGGAAGTAAGCAGGAGAGAGG + Intergenic
1177112136 21:17041431-17041453 CAGGGTAAAGTGTAGGAGGGGGG - Intergenic
1177521412 21:22232704-22232726 AAGGAAAAAAGGAAGGAGGGAGG + Intergenic
1177815304 21:25969943-25969965 AAGGGAAGAAGGAAGGAGGGAGG + Intronic
1178286688 21:31331413-31331435 CAGGGGAAAAATGAGGAAGGAGG + Intronic
1178598346 21:33974757-33974779 AAGGGAAAAAAGAAGGAAAGAGG - Intergenic
1178808574 21:35860130-35860152 GAGGGAGGAAAGAAGGAGGGAGG + Intronic
1178808588 21:35860169-35860191 GAGGGAAAAGAGAGGGAGGGAGG + Intronic
1178903009 21:36612851-36612873 CCGGAATAAAAGCAGGAAGGAGG - Intergenic
1179141138 21:38726527-38726549 GAAGGAAAGAAGGAGGAGGGAGG - Intergenic
1179420936 21:41236353-41236375 CAGGGAACAAAGCAGGCAAGGGG - Intronic
1179768209 21:43590843-43590865 CAGGGAGAGGAGCAGGAAGGAGG + Intronic
1179875106 21:44263105-44263127 CAGGGAAGGGAGCAGGAAGGTGG + Intergenic
1180237628 21:46473454-46473476 CAGGGAAAAAAAAAGGGGGGGGG + Intronic
1180244625 21:46538920-46538942 CAGGACAAAGGGCAGGAGGGTGG - Intronic
1180750497 22:18121218-18121240 CAGGAAAGAAAAAAGGAGGGTGG - Intronic
1181097746 22:20517508-20517530 CAGTGAAAAGAGCAGGGTGGTGG - Intronic
1181119723 22:20657798-20657820 GAGGGTGACAAGCAGGAGGGGGG + Intergenic
1181289300 22:21778594-21778616 CAGGAAAAAAAAAAGGGGGGGGG + Intronic
1181663371 22:24370922-24370944 GAGGGAAAAAAGAAAGGGGGTGG + Intronic
1181907342 22:26209822-26209844 AAAGGAAAAAAGTAGGAGGAAGG + Intronic
1181920513 22:26316945-26316967 AAAGGAAGAAAGAAGGAGGGAGG + Intronic
1182033165 22:27176067-27176089 AAGGGAAAAAAGCAGAAGGAAGG + Intergenic
1182083183 22:27543518-27543540 CAGAGAAACAGGGAGGAGGGAGG - Intergenic
1182083206 22:27543604-27543626 CAGGGAAGAAAGAGGAAGGGAGG - Intergenic
1182136361 22:27907568-27907590 AAGGGAAAAAGGCAAGAGGGTGG - Intronic
1183018095 22:35006438-35006460 CAGGGCTAAAAGCAGGAGCCAGG + Intergenic
1183172967 22:36201566-36201588 CAGTGAACAAAGCAGGAAGAAGG - Intronic
1183180309 22:36255412-36255434 CAGTGAACAAAGCAGGAAGAAGG + Intronic
1183188186 22:36304508-36304530 AGGGGAAAAAAGGAGCAGGGTGG + Intronic
1183311067 22:37109719-37109741 CAGGTAAACAGGCAGGAGGTAGG + Intergenic
1183613057 22:38923698-38923720 GAGGGAAGAAAGGAGGAGGGAGG - Intergenic
1183613072 22:38923747-38923769 GAGGGAAGAAAGGAGGAGGGAGG - Intergenic
1184105202 22:42363400-42363422 CAGGGAAAGAAGCTGAAAGGTGG + Intergenic
1184481918 22:44752876-44752898 CAGGGGAAAAAGCAGAGGAGGGG - Intronic
1184747255 22:46463594-46463616 CGGGGAAAACAGCTGGAGGATGG - Intronic
1184866518 22:47204611-47204633 CAGGGGACAAAGCTGCAGGGCGG - Intergenic
1185006820 22:48282870-48282892 GAGGGAAAAAAGAAGGAGGGAGG + Intergenic
1185056079 22:48578944-48578966 GAGGGAACAAGGCAGGCGGGTGG + Intronic
1185071593 22:48659597-48659619 CAGGGAGAAAAGCAGGACAAGGG - Intronic
1185120313 22:48962393-48962415 GAAGGAAACAAGCAGCAGGGTGG + Intergenic
1203289113 22_KI270735v1_random:17240-17262 ATGGGAGAAAAGAAGGAGGGCGG - Intergenic
949433326 3:4002095-4002117 CTGGGAAAACTGCATGAGGGTGG + Intronic
949920033 3:8993279-8993301 AAGAGAAAAAAGGAGGAGGTAGG - Intronic
950542207 3:13619382-13619404 CAGGGAAAAAAGCAGGGGAAGGG - Intronic
950772567 3:15323936-15323958 AAGGGAAATAAGCAGTATGGGGG + Intronic
951050132 3:18084753-18084775 CAGGGTAAAATGTTGGAGGGAGG + Intronic
951150079 3:19278384-19278406 AAGGAAAAAAGGAAGGAGGGAGG + Intronic
951243451 3:20313796-20313818 CGGGGGAAGAAGCAGGATGGAGG - Intergenic
951721593 3:25704476-25704498 CAGTAATAAAAGCAGCAGGGAGG + Intergenic
951906684 3:27713904-27713926 GAGGGAAAAAAGGAAGAAGGGGG - Intergenic
952546023 3:34420091-34420113 CAGGCATAACAGCAGAAGGGTGG + Intergenic
952571733 3:34725918-34725940 CAGGCAGAAAGGCAGGAGTGGGG - Intergenic
952740741 3:36731791-36731813 GAGGGAGAAAAGAAGGAGTGAGG - Intronic
953119587 3:40026871-40026893 CAGGGAAAAAGGCTGAAGAGGGG - Intronic
953346556 3:42180700-42180722 AAGGAAAAAAAGGTGGAGGGTGG + Intronic
953908440 3:46880278-46880300 CAAGGACAAAGGCAGGAGAGTGG + Intronic
954354438 3:50073142-50073164 CAGGGGATAAAGGAGGAGGATGG - Intronic
954688104 3:52381552-52381574 CAGAGAAGAAAGCGGGTGGGTGG + Intronic
955407659 3:58635651-58635673 CAGTGAAGAACGCAGGAGGCCGG - Intronic
955525511 3:59815732-59815754 AAGGGAAAAGAGTGGGAGGGGGG + Intronic
955536072 3:59925078-59925100 AAGGGAAAAAAATAGGAAGGAGG - Intronic
955555706 3:60134966-60134988 CAGGAAAAAAGGGGGGAGGGAGG + Intronic
955644935 3:61126974-61126996 CCAAGAAAAAAGCAGGAGGAAGG + Intronic
956360596 3:68442608-68442630 GAAGGAAAAAAGAAAGAGGGAGG + Intronic
956371775 3:68571020-68571042 CAGGTAAAGCAGCATGAGGGAGG - Intergenic
956409016 3:68959517-68959539 CAGGGGGAAGGGCAGGAGGGGGG - Intergenic
956603606 3:71049629-71049651 CAGGAAAAAAAGGGGGTGGGGGG + Intronic
956727541 3:72168804-72168826 CAGGGAAAAACACAGGGTGGTGG - Intergenic
958609491 3:96406344-96406366 AAGCGGGAAAAGCAGGAGGGAGG + Intergenic
959871161 3:111330019-111330041 CAGAGAAGAATGCAGCAGGGTGG + Intronic
960221385 3:115113456-115113478 CAGTGCCAAAAGCAGGAGGCAGG - Intronic
960390853 3:117075923-117075945 CAGGGAAAAAAACATGAGGATGG - Intronic
960874529 3:122283906-122283928 CAGGGAGAAGAGGAGGAGGTAGG - Exonic
960949064 3:122987215-122987237 AAGGGAAAAATGCAGGTGGAGGG + Intronic
961121427 3:124374519-124374541 CAGGGATAGAAGCAGAAGTGTGG + Intronic
961175269 3:124830261-124830283 CAGGGAAAAACTGTGGAGGGTGG - Intronic
961340161 3:126212417-126212439 AAGGGAGGAAAGAAGGAGGGAGG + Intergenic
962377790 3:134873160-134873182 GAGAGAAAAAGGAAGGAGGGAGG + Intronic
962403811 3:135083293-135083315 CAGAGGAGAAAGCAGCAGGGGGG + Intronic
963272683 3:143301379-143301401 CAGAGAAATCAGCAAGAGGGCGG + Intronic
963957768 3:151274385-151274407 AAGTGAAAAAAGGAAGAGGGAGG - Intronic
964027132 3:152088161-152088183 CAGGAAAAACAGCAGGATGGGGG + Intergenic
964501496 3:157353228-157353250 CAGAGAAGAAAGCGAGAGGGAGG - Intronic
964754376 3:160080628-160080650 CAGGGAAATAAGCCCAAGGGAGG - Intergenic
965012086 3:163107204-163107226 CAGGTAAACAGCCAGGAGGGGGG - Intergenic
966031947 3:175360450-175360472 TAGGAAAAGAAGCAAGAGGGAGG - Intronic
966352521 3:179046366-179046388 CAGGGAAAATAGCAGACAGGAGG + Intronic
966710721 3:182969735-182969757 CAGCAAAAAAAGCAGGGGGGAGG + Intronic
966735335 3:183182559-183182581 TAGGAGACAAAGCAGGAGGGGGG + Intronic
966854281 3:184183704-184183726 AAGGCAGCAAAGCAGGAGGGAGG - Exonic
967218823 3:187232230-187232252 CAAGGAAAAAAAAAGGGGGGGGG - Intronic
967301925 3:188022609-188022631 CAGGGGAAAAGGCAGGATGGAGG - Intergenic
967350714 3:188511160-188511182 CAGGTAGAAAGGAAGGAGGGAGG - Intronic
967563251 3:190942754-190942776 AAGGGAAATAAGAAGGAGGGAGG - Intergenic
967597950 3:191349970-191349992 CAGGAAAAAAAAAGGGAGGGGGG - Intronic
968003623 3:195224669-195224691 GAGGGAAAGAGGCAGGAGGGAGG + Intronic
968609112 4:1549132-1549154 CAGGTGAGAAAGCAGGCGGGAGG + Intergenic
969315635 4:6380032-6380054 CAGGAAACCAAGGAGGAGGGAGG - Intronic
969353866 4:6613825-6613847 GAAGGAAAAAAGAGGGAGGGAGG + Intronic
969421123 4:7096546-7096568 CCGGGAAAGACGCAGGAAGGAGG + Intergenic
969660206 4:8523010-8523032 CTGTGATAAAAGCAGGAGGTGGG - Intergenic
970535159 4:17023097-17023119 GAGGGAAAAAAGCTGGAGAGGGG + Intergenic
970641321 4:18069488-18069510 CAGGGAAGAGAGGTGGAGGGAGG - Intergenic
970886648 4:20994021-20994043 CAAGGATAAAAGAAAGAGGGAGG - Intronic
971019148 4:22516379-22516401 AAGGGAAACGAGCAGGAGAGTGG - Intergenic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971303024 4:25457305-25457327 CAGGGGAAAAAGCGGTAAGGAGG - Intergenic
971932386 4:33101806-33101828 GAAGGAAAAAAGAAGGAAGGAGG - Intergenic
972255001 4:37344394-37344416 AAGGGAGAAAAGCTGGAGGCAGG + Intronic
972582603 4:40407806-40407828 CAGTCAGAGAAGCAGGAGGGTGG - Intergenic
972640245 4:40918737-40918759 CAGAGAAAAAATAAGGAAGGAGG - Intronic
974385869 4:61201582-61201604 CAGAGAAAGCAGCAGGAGGGTGG - Intronic
974796102 4:66752293-66752315 CAGGAATAAAATCAGGAAGGAGG - Intergenic
975193133 4:71489936-71489958 CAGGGAAAAGAGCAGGAGAGAGG + Intronic
975228464 4:71902925-71902947 CAGGCAGAAAGGAAGGAGGGAGG - Intergenic
975642934 4:76518460-76518482 CAGGCAAAAAGGAAGGAGGGGGG - Intronic
976897000 4:90125396-90125418 CATTGTAAAAAGAAGGAGGGAGG + Intergenic
977174183 4:93798951-93798973 CAGAGAAAAAAGCAGGGGGTAGG + Intergenic
977180422 4:93866952-93866974 CAGGGAGAAAAGGAGTAGGTGGG - Intergenic
977745174 4:100538475-100538497 CAGAGAAATGAGCAGGAGGGTGG + Intronic
977917552 4:102611206-102611228 CAGGAAGAAAAGCCAGAGGGAGG + Intronic
978072819 4:104492326-104492348 CAGGGAAAGAAGGAAGACGGGGG + Intronic
978203050 4:106045678-106045700 AAGGAACAAAAGAAGGAGGGAGG - Exonic
978712946 4:111807655-111807677 AAGAGAAAAAAGCAGGAGGTCGG + Intergenic
978776795 4:112513803-112513825 AAAGGGAAAAATCAGGAGGGAGG - Exonic
978957989 4:114638520-114638542 CAAGGAAAACAGATGGAGGGAGG - Intronic
979003840 4:115262587-115262609 CATGGAAAAAATCAGGAGGCTGG + Intergenic
979621808 4:122806492-122806514 CAGTGAAATAAGAAGCAGGGGGG + Intergenic
980034748 4:127871030-127871052 TAGGGAAAACAGCAGGAGTGAGG + Intergenic
980253789 4:130350193-130350215 GAAGGAAAAAGGAAGGAGGGAGG - Intergenic
980312216 4:131145783-131145805 CAGGGCAAAGAGTGGGAGGGGGG + Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
980707290 4:136515907-136515929 CATGGAAATAAGTAGGATGGAGG + Intergenic
980795164 4:137673305-137673327 GAAGGAAAAAAAAAGGAGGGTGG - Intergenic
980894953 4:138853224-138853246 GAAGGAAAGAAGCAGGAGGGAGG + Intergenic
981394295 4:144229083-144229105 GATGAAAAAAAGGAGGAGGGAGG + Intergenic
981498253 4:145417554-145417576 GAGGGAAGAAGGAAGGAGGGAGG + Intergenic
981618991 4:146672692-146672714 CTGGGAAAAAAGCAGAGGGAGGG + Intergenic
981775938 4:148367961-148367983 GAGGAAATACAGCAGGAGGGCGG - Intronic
982010631 4:151102629-151102651 GAGGGTAGAAAGGAGGAGGGAGG + Intronic
982464422 4:155712689-155712711 CAAAGAAAAAAGTAAGAGGGAGG + Intronic
982605902 4:157515613-157515635 CAGGTAAAAACGAAGAAGGGAGG - Intergenic
983094922 4:163550312-163550334 AAAAGAAAAAAGCAGGAGGTAGG + Intronic
983261489 4:165461537-165461559 GAGGGAAAAGAGCTGGAGAGAGG + Intronic
984473201 4:180203482-180203504 CTGAGAAAAGAGTAGGAGGGAGG + Intergenic
984760092 4:183356419-183356441 CAGGGAGAAAGGAGGGAGGGAGG - Intergenic
984908811 4:184652961-184652983 AAGGGAAAGAAGAGGGAGGGAGG + Intronic
984908826 4:184653020-184653042 AAGGGAAAGAAGAGGGAGGGAGG + Intronic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985029558 4:185775370-185775392 AAGGAAAAAAAGCAAGAGAGAGG + Intronic
985446528 4:190023822-190023844 GAGGGAGAGAAGGAGGAGGGAGG - Intergenic
985523124 5:388482-388504 CTGGGAGAAAAGCAGCAGTGGGG - Intronic
985566354 5:620279-620301 CGGGGACAAAAGCATGAGCGTGG - Intronic
986128692 5:4907473-4907495 CAGGGAAAAAAGCACTGAGGAGG + Intergenic
986283831 5:6345593-6345615 CAGAGAACAGAGGAGGAGGGAGG + Intergenic
986597799 5:9441658-9441680 CAAGGAAGTAAACAGGAGGGTGG + Intronic
986827023 5:11532881-11532903 CAGGAGAAAAAGAAGGAGGGAGG + Intronic
987343145 5:16956056-16956078 CAGGGAAAAAAAAAGAGGGGGGG + Intergenic
988232057 5:28492026-28492048 CAGGGCAAAAGGTAGGAGGAGGG + Intergenic
989488167 5:42016355-42016377 AAGGAAAAAAAAAAGGAGGGAGG - Intergenic
989981893 5:50655475-50655497 GAGGGAAGAAGGAAGGAGGGAGG - Intergenic
990003775 5:50922713-50922735 CAGGTGAGAAAGCAGGCGGGAGG - Intergenic
990252907 5:53935056-53935078 CAGGGATAAAAAGAGGAGGGAGG + Intronic
990805953 5:59662094-59662116 CAGGGTAAAGAGCAAGAGGCTGG - Intronic
991100702 5:62789347-62789369 AAGGGTACAAAGCAGGAGGCAGG + Intergenic
991398108 5:66225592-66225614 CAGGGAAAGAAGCAGGAGTTTGG + Intergenic
991947647 5:71915238-71915260 CAGGGGAAAGAGCAGGAAGGAGG - Intergenic
992589333 5:78277383-78277405 CAGGAAAAAAAGGAGAAGGGAGG + Intronic
994128907 5:96201590-96201612 TAGGGAAAAATGTAGGAGTGGGG - Intergenic
994976780 5:106818379-106818401 CAGGTAAAGAAGGAGGAGGAAGG - Intergenic
995443801 5:112220781-112220803 CAGGGGAAAAAGGAGGAAGAAGG - Intronic
995533529 5:113113783-113113805 GAGACAAAACAGCAGGAGGGAGG + Intronic
995824204 5:116275342-116275364 TTGGGAATAAAGCAGGATGGGGG - Intronic
995885328 5:116888152-116888174 AAGGGAGAGCAGCAGGAGGGTGG + Intergenic
996255926 5:121402968-121402990 CATGAAAAAAGCCAGGAGGGTGG + Intergenic
997285158 5:132672715-132672737 CTGGGAGAAAAGCAGGGGGCAGG + Intergenic
998261303 5:140633738-140633760 CAAGGAAAAAAAAAGGAAGGGGG - Intergenic
998350356 5:141496355-141496377 CAGGGAGAGAAGCAGGAGCTTGG + Intronic
999258185 5:150221559-150221581 CAGGGCAGAGAGGAGGAGGGAGG - Intronic
999692680 5:154162345-154162367 GAGGGAAAAAAGTAGGGAGGAGG + Intronic
999751701 5:154632325-154632347 GAGGGAAGGAAGAAGGAGGGAGG - Intergenic
999872330 5:155765419-155765441 AAGGGAAAGAGGGAGGAGGGAGG + Intergenic
1000041313 5:157487188-157487210 AAAGGAAAAAAGCAAGAGAGGGG - Intronic
1000839088 5:166194133-166194155 AAAGGAAAAAATTAGGAGGGAGG - Intergenic
1001129029 5:169047970-169047992 GAAGGAAGAAAGCAGGAGGAAGG + Intronic
1001400350 5:171442621-171442643 AAGAGAACAAAGCTGGAGGGTGG - Intronic
1001706091 5:173742017-173742039 CAGTGCAAGAAGCAGGTGGGAGG + Intergenic
1002209050 5:177585099-177585121 CAGAGAAAGAAGGAGGAGGAAGG + Intergenic
1002319377 5:178365897-178365919 CAGTGAACACAGCAGGAAGGGGG + Intronic
1002941442 6:1720152-1720174 CAAGGAAAAAAGGAGGAAGTTGG + Intronic
1003752503 6:9075509-9075531 GAGAGAAAAAAACGGGAGGGAGG - Intergenic
1004333889 6:14746450-14746472 CAAGCAAAAAAGGATGAGGGAGG + Intergenic
1004543460 6:16573759-16573781 CAGGGACAAAAGCATGAGGAAGG - Intronic
1004715474 6:18212881-18212903 CAAGAAAGAAAGCAGAAGGGGGG - Intronic
1004882448 6:20022471-20022493 CACAGAAAAAGGCAGGAGTGTGG + Intergenic
1005231312 6:23704645-23704667 CAGGGGAAGGAGTAGGAGGGAGG + Intergenic
1005440251 6:25859868-25859890 CAGGGTAAAAAGTAAGGGGGAGG - Intronic
1005646919 6:27848265-27848287 TAGGAGAAAAAGCAGGAGGAGGG - Intronic
1005763267 6:28987029-28987051 CAGGAGAAAGAGCAGGGGGGCGG + Intergenic
1006021754 6:31121522-31121544 CAGGGGCCAGAGCAGGAGGGAGG - Intronic
1007161357 6:39793727-39793749 AGGGGAAAAAAGCAGCAGTGAGG + Intronic
1007322951 6:41040465-41040487 CAGGGAAGGAAGCAGAGGGGAGG - Intronic
1007373895 6:41443518-41443540 TGGGGGTAAAAGCAGGAGGGAGG + Intergenic
1007375129 6:41451334-41451356 CTGTGGAAAAGGCAGGAGGGAGG - Intergenic
1007864710 6:44955721-44955743 CAGGGGAAAGGGTAGGAGGGGGG + Intronic
1007906412 6:45465941-45465963 CATAGAAAAAAGAAGTAGGGCGG - Intronic
1008265886 6:49425790-49425812 CAGAGAAAAAAGTAGAATGGTGG - Intergenic
1008372064 6:50744189-50744211 GAGGGTAAAAAGTAGGAGGGTGG - Intronic
1009251586 6:61307551-61307573 CAGGACAAAAAGTAGAAGGGAGG - Intergenic
1009260043 6:61474556-61474578 CAGGATAAAAAGCAGAAGGAAGG + Intergenic
1009332548 6:62441670-62441692 GAGGGAAAATAGCAGATGGGGGG - Intergenic
1009488376 6:64254614-64254636 CAGGGAACAAAGCAAGAGGAAGG - Intronic
1010244534 6:73651053-73651075 CAGGGAAAAGAAAAGGAGCGGGG + Intronic
1010275401 6:73962948-73962970 AAGGGGAAAAAGCAGGCAGGAGG + Intergenic
1010679704 6:78784122-78784144 AAGGGAACAAAGCTGGACGGAGG + Intergenic
1010704290 6:79089600-79089622 AAGGAAAGAAAGAAGGAGGGAGG - Intergenic
1011744600 6:90397290-90397312 CAGAGCAATTAGCAGGAGGGAGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012424857 6:99102686-99102708 CAGTGAGAAAAGGAGCAGGGAGG + Intergenic
1012604886 6:101145493-101145515 AAAGGAAAAAAACAGGAGGATGG - Intergenic
1012752966 6:103185768-103185790 AAGGGAAGAAGGGAGGAGGGAGG + Intergenic
1013155394 6:107488448-107488470 AAGAGAAGAAATCAGGAGGGAGG + Intergenic
1013327612 6:109063271-109063293 AAGAGAAATAAGTAGGAGGGTGG + Intronic
1013360896 6:109393187-109393209 CAGGGAGAAAAACAGAGGGGAGG - Intronic
1013476511 6:110511974-110511996 CAGGGAAGAAAGCAAGATGTAGG - Intergenic
1013685994 6:112583771-112583793 CAGGGAAAAAACTGGGAGGTGGG - Intergenic
1014212339 6:118720180-118720202 GAGGGAAAAAGGAAGGAAGGAGG - Intergenic
1014545698 6:122733045-122733067 CAGGGAAAAAAGAAGGTGGTGGG - Intergenic
1014596787 6:123353644-123353666 AAGGGAAGAAGGAAGGAGGGAGG + Intronic
1015163960 6:130182612-130182634 GAGGGAAGAAAGAAGGAGGGAGG + Intronic
1015166154 6:130202323-130202345 GATGCAAAAAAGCAGGAGCGGGG - Intronic
1015383023 6:132591399-132591421 CAGGTCAAAAAGAAGGAAGGAGG + Intergenic
1015525916 6:134175365-134175387 CAGGGATAAACCCCGGAGGGTGG - Intronic
1015646830 6:135400870-135400892 AAGGGAAAAAAACAGGCTGGAGG - Intronic
1016498396 6:144690150-144690172 AAGGGGCAAAACCAGGAGGGAGG + Intronic
1016531715 6:145065689-145065711 CAGGGAAAAGAGGAGGAGTTTGG + Intergenic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1017971753 6:159317822-159317844 AAGGGGCAAAAGCAGGATGGAGG + Intergenic
1018789355 6:167134751-167134773 CAGGGAAAAGAGGAGGAAGATGG + Intronic
1018985904 6:168636965-168636987 GAGGGAGGAAAGCAGGAGGGAGG - Intronic
1019095072 6:169573050-169573072 AAGGGAAGAAAGCAGGAGTGCGG - Intronic
1019355535 7:576909-576931 CAGGCCGAAAAGCAGGAGGCTGG - Intronic
1019549245 7:1594006-1594028 GAGGGAAAGAAGAAGGAGGAGGG - Intergenic
1019805121 7:3117929-3117951 AAGGGACAAATGCAGGAGGGTGG - Intergenic
1020238631 7:6375024-6375046 CCGGGAAGAAAGCCGGAGGGTGG - Intronic
1020902948 7:14028180-14028202 CAGTTAAAAATGCAGGAGGTTGG - Intergenic
1021378303 7:19935601-19935623 CAGGGAATAAGGTAGGTGGGAGG + Intergenic
1021962348 7:25885402-25885424 GAAGGAAAAAAAAAGGAGGGAGG - Intergenic
1022095337 7:27137246-27137268 CAGGGGAAAGAGCAGGAGAAAGG + Intronic
1022216060 7:28262784-28262806 GAAGGAAAGAAGGAGGAGGGAGG - Intergenic
1022473329 7:30694853-30694875 AAGGGAAGAAAGGAGGAAGGAGG + Intronic
1022594204 7:31696509-31696531 GAGGTGAGAAAGCAGGAGGGCGG + Intronic
1022597039 7:31722655-31722677 CAGGTGAAGAAGCAGGATGGTGG + Intergenic
1022624414 7:32019935-32019957 CAGGGAAAAGAGCAAGCTGGAGG + Intronic
1023083976 7:36551547-36551569 AAGGGCAGAAAGTAGGAGGGTGG - Intronic
1023449269 7:40265462-40265484 AAGGAAGAAAAGAAGGAGGGGGG - Intronic
1023908721 7:44539445-44539467 CAGGGACAAAAGCAAGATGGTGG - Exonic
1024076886 7:45825628-45825650 AAGGGAAAAAAGCAGCATGCAGG - Intergenic
1024242726 7:47447995-47448017 CAGAGAAGACAGCAGGAGGCTGG + Intronic
1024620609 7:51154233-51154255 CAGAGGAAAAACCATGAGGGTGG + Intronic
1024634365 7:51275320-51275342 GAGGGAAAAAACCAGGAGGATGG - Intronic
1024655302 7:51446897-51446919 CAGGATAAAAAACAGGATGGAGG - Intergenic
1024723450 7:52165361-52165383 AAGGGAAAACTGCAGGAGAGTGG - Intergenic
1024799319 7:53057899-53057921 CAAGGAAGAAAGAAAGAGGGAGG - Intergenic
1025481393 7:60988141-60988163 AAAAGAAAAAAGGAGGAGGGGGG - Intergenic
1026076712 7:67178168-67178190 CAGAAAAAAAAACAGGAGGTGGG + Intronic
1026206297 7:68260709-68260731 AAGGGAAAGAAGAAGGAGGATGG - Intergenic
1026268524 7:68816452-68816474 AAGGGAAAAAGGAGGGAGGGAGG + Intergenic
1026379010 7:69780526-69780548 TAGGGCAAAGAGGAGGAGGGCGG + Intronic
1027841684 7:83320318-83320340 CAGGGAGAAAAGCAGGAATTTGG + Intergenic
1028382161 7:90211828-90211850 CAGGGGAGAAGGAAGGAGGGAGG - Exonic
1028760594 7:94491775-94491797 CAGGGGAAAGAGTGGGAGGGAGG + Intergenic
1028791069 7:94853586-94853608 CAGGGAGAAGAGAAGGATGGGGG - Intergenic
1028931204 7:96415009-96415031 CAGGGAGAAAAGCATGAAAGAGG - Intergenic
1029204879 7:98863634-98863656 GAGGGAAGGAAGAAGGAGGGAGG - Intronic
1029315784 7:99712076-99712098 CAGGAAAAAAATCAAGAGAGGGG - Intronic
1029451038 7:100641879-100641901 GAGGGGTAAAAGCAGGAGAGGGG - Intronic
1029584867 7:101463841-101463863 AAGAGAAAAAAGAGGGAGGGAGG - Intronic
1029677085 7:102077230-102077252 CAGAGAAAGCAGCAGCAGGGAGG + Intronic
1029872080 7:103705013-103705035 CAGGAGAAAAATCAAGAGGGTGG - Intronic
1029995135 7:105000530-105000552 GATGGAAAAAAGGAGGAGGATGG + Intergenic
1030153529 7:106429050-106429072 CAGGGCAAGAAGCAGGAGTATGG - Intergenic
1030396532 7:108993671-108993693 AAGAGAGAAAACCAGGAGGGAGG - Intergenic
1031981662 7:128130913-128130935 CAGGGAGAAAAGGAGGAAGGAGG - Intergenic
1032996116 7:137448559-137448581 GAGGGAGAGAAGGAGGAGGGAGG + Intronic
1033478658 7:141716355-141716377 TAGGGAAGAAGGGAGGAGGGAGG - Intronic
1033583329 7:142755819-142755841 GAGGGAAGAGAGAAGGAGGGTGG - Intronic
1033586340 7:142777327-142777349 GAGGGAAGAGAGAAGGAGGGTGG - Intergenic
1033961083 7:146913900-146913922 CAGGGGAAAGGGTAGGAGGGTGG - Intronic
1034020820 7:147640727-147640749 CAGGCAAGAAAGAAGGAAGGAGG + Intronic
1034059347 7:148072142-148072164 CAGGGGTAAAGGTAGGAGGGAGG - Intronic
1034323274 7:150204907-150204929 CAAGGAACATAGCAGGAAGGGGG + Intergenic
1034492380 7:151400320-151400342 AAGGGAAGAAAGCAGGATGTAGG + Intronic
1034599218 7:152232593-152232615 CAGGGAAATAAGAAGGACTGAGG + Intronic
1034713840 7:153220941-153220963 CAAGAAAAAAAGGAGGAGGTAGG - Intergenic
1034738003 7:153446804-153446826 CAGGGAATAAAACAGAAGGAAGG - Intergenic
1035457246 7:159016592-159016614 CAGGGTGCCAAGCAGGAGGGTGG - Intergenic
1035757110 8:2042901-2042923 AAGGGACAAAAGACGGAGGGAGG - Intergenic
1036571152 8:9980609-9980631 CAAGAAAGAAACCAGGAGGGAGG - Intergenic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1037529894 8:19762863-19762885 CAGGGAAAATAGCCTGAGGAAGG + Intergenic
1037902744 8:22697149-22697171 GAGGGAGGAAACCAGGAGGGAGG - Intergenic
1037916047 8:22774056-22774078 CTGTGAAACCAGCAGGAGGGAGG - Intronic
1037990249 8:23316733-23316755 TGGGGAGAAAAGCGGGAGGGAGG - Intronic
1038432153 8:27509056-27509078 TAGAGAAAAAAGCAGGATGGGGG - Intronic
1038684586 8:29704724-29704746 CAGGGAGAAAAGTGGGAGGGGGG - Intergenic
1038914407 8:32004479-32004501 TAGGGAAAAACTCGGGAGGGTGG + Intronic
1038920557 8:32078778-32078800 CATGGAACTAAACAGGAGGGAGG - Intronic
1039164863 8:34666920-34666942 CAAAGAAAAAAGTGGGAGGGGGG - Intergenic
1039560683 8:38510324-38510346 CAGTGAAAAACGCTGCAGGGTGG + Intergenic
1039774080 8:40718645-40718667 GAGGGAAAGAAGAAGGAGGCTGG - Intronic
1040034733 8:42859251-42859273 CAGGGAAAAAAGTAGAAGTGAGG + Intronic
1040039998 8:42906147-42906169 AAGGGAAAAAAAGAGGGGGGGGG - Intronic
1040574914 8:48643576-48643598 CAGGGAGATAAGCCAGAGGGCGG - Intergenic
1040723837 8:50357124-50357146 GTGGGAAATGAGCAGGAGGGAGG - Intronic
1041085301 8:54251215-54251237 CATAGCAAAAAGCAGAAGGGTGG - Intergenic
1041097167 8:54361578-54361600 AGGGGAAAAAGGCAAGAGGGAGG - Intergenic
1041538444 8:58955375-58955397 AAGGAATAAAAGCAGGAAGGTGG + Intronic
1041645069 8:60243276-60243298 CCTGGAAAAGAGGAGGAGGGAGG - Intronic
1041691395 8:60691486-60691508 CAGTGAGAAAAGGAGGATGGGGG - Intronic
1041800475 8:61792471-61792493 CAGGGAAAAAGGAGGGAGAGTGG + Intergenic
1041965174 8:63667765-63667787 CAGGAAAGCAACCAGGAGGGGGG + Intergenic
1042539347 8:69892499-69892521 AAGGGATAAAAGCAGAAGGCCGG + Intergenic
1042586475 8:70344672-70344694 CAGGGATAAAAGCAGGACTGGGG + Intronic
1042712828 8:71737246-71737268 GGGGGAAAAAAGCAGAGGGGAGG - Intergenic
1042865013 8:73349388-73349410 CAGGGAGAGAAGCAGGGTGGTGG - Intergenic
1043691614 8:83160463-83160485 CAGGGAAAAGGGTGGGAGGGGGG - Intergenic
1044055444 8:87564254-87564276 CAGGGCATAAGGCAGGAGGCAGG - Intronic
1044195418 8:89371666-89371688 GAGGGAAGGAAACAGGAGGGAGG + Intergenic
1044524204 8:93233152-93233174 CAGGGAAAATAGGAGGCGAGGGG - Intergenic
1044769366 8:95613888-95613910 CAGGGAAAAGGGCAGGAAGGGGG - Intergenic
1045760175 8:105596425-105596447 CAGGGTAAAAACTAGGATGGTGG - Intronic
1046550038 8:115704626-115704648 TGGGGAATAAAGCAGCAGGGAGG + Intronic
1046731155 8:117727795-117727817 CAAGGGAAAAAGGATGAGGGAGG - Intergenic
1046733561 8:117751745-117751767 GAGGCAAAAAAGCAGCAGGCAGG - Intergenic
1047009363 8:120654288-120654310 CTAGGAAAAAAGAGGGAGGGAGG + Intronic
1047116215 8:121844239-121844261 CAGGGAAAAAGGGAAAAGGGAGG + Intergenic
1048263327 8:132964255-132964277 GAGGGAAGAAAGCAGGGGGCAGG - Intronic
1048357034 8:133661982-133662004 ATGGGAAAAAAGAACGAGGGTGG + Intergenic
1048848791 8:138624462-138624484 AAGGAAAGAAAGGAGGAGGGAGG + Intronic
1049120900 8:140736359-140736381 CAGGGAATAAAACAGCAGGGAGG + Intronic
1049335718 8:142083666-142083688 CATGGAATACAGCAGGAGAGAGG + Intergenic
1049343945 8:142128579-142128601 CTGGGAAAAGAGCAGGAGGGTGG + Intergenic
1050038245 9:1460645-1460667 CAGGAAGAAAAGCAGGCGGGGGG + Intergenic
1050366955 9:4881680-4881702 GAGGGAAGAAGGGAGGAGGGAGG - Intronic
1050479069 9:6071141-6071163 CAGGGAAGGAAACAGGAGTGAGG - Intergenic
1050633020 9:7580696-7580718 CTGAGAAAAAAGCAGGAGCTGGG + Intergenic
1050953205 9:11623699-11623721 ATGGGAAAGAAGCAGGAAGGAGG + Intergenic
1051097463 9:13483209-13483231 CATGGAAAAGAGGAGGAGGAAGG - Intergenic
1051301846 9:15660463-15660485 GAGGGAAAAGGGCAGGAAGGGGG - Intronic
1051681986 9:19616884-19616906 CAGGGAAAAATGGAAGGGGGTGG + Intronic
1051712382 9:19945302-19945324 GAGGGGAAAAGGAAGGAGGGAGG + Intergenic
1051800581 9:20928901-20928923 CAGGGAAGAAAGGAAAAGGGAGG - Intronic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1052882564 9:33612694-33612716 CAGGAAGAAAAGCAGCAGGAAGG - Intergenic
1052900820 9:33793576-33793598 CAGGAAGAAAAGCAGGAGGAAGG + Intronic
1052902088 9:33801985-33802007 GAGGGAAGAGAGAAGGAGGGTGG - Intergenic
1052902362 9:33804271-33804293 CAGGAAGAAAAGCAGGAGGAAGG + Intergenic
1053154695 9:35768793-35768815 CAGGTAGATAAGCAGGAGAGGGG + Intergenic
1053275536 9:36780572-36780594 CAGGGGGAAAAGCAAGGGGGAGG - Intergenic
1053374122 9:37590716-37590738 CAATGAAAAAGGCAGGAGGCAGG + Intronic
1055624948 9:78166836-78166858 CAGGGAAAAAAGCAGGAAGAAGG - Intergenic
1055626225 9:78179635-78179657 CAGGGAACAAAGCTGGAGCCTGG - Intergenic
1055703454 9:78971818-78971840 AATGGAGAAAAGAAGGAGGGAGG + Intergenic
1055708252 9:79031885-79031907 GAGGGGAAGAAGAAGGAGGGAGG + Intergenic
1055750665 9:79501176-79501198 CAGAGAGAAAAGGGGGAGGGTGG + Intergenic
1056485706 9:87055072-87055094 CAGAGAGAAAAGGAGGTGGGAGG + Intergenic
1056522096 9:87411198-87411220 CGGAGCAAAAAGCAGGAGGACGG - Intergenic
1057002123 9:91519641-91519663 GAAGGAAAAAAACAGGAGGGAGG + Intergenic
1057167624 9:92941139-92941161 GAGGGAAAACAGCAGGGGGAAGG + Intergenic
1057306077 9:93912781-93912803 CAGGGAGAAAGGCAGGGGCGGGG - Intergenic
1057412028 9:94825288-94825310 CAGGCAAAACAGCAGGATGCGGG - Intronic
1057799202 9:98179639-98179661 CAGGGATGAGGGCAGGAGGGAGG + Intronic
1057813876 9:98279729-98279751 GAGGGAAGAAAGGAGGAGGGAGG - Intergenic
1058309095 9:103478588-103478610 TAGGAAAAAAAGAAGGAAGGAGG - Intergenic
1058914854 9:109555838-109555860 AAGGGATAAAAGAAGGAAGGGGG + Intergenic
1058959946 9:109983430-109983452 GAGGAAAAAAAGGAGGAGTGGGG - Intronic
1059501718 9:114759973-114759995 CAGGGAAAAATCCAGGAGCGTGG - Intergenic
1059718678 9:116937294-116937316 CAGGGAATAAGGAAGGAGGTGGG - Intronic
1060116139 9:120942517-120942539 AAGGGAGAAAGGAAGGAGGGAGG + Intergenic
1060554545 9:124501536-124501558 GAGGGGAAAGAGCAGGAGAGAGG + Intronic
1060967645 9:127720803-127720825 GAGGGAAGAAAGAAGGAGGGAGG - Intronic
1061277603 9:129578469-129578491 GAGGAAGAAAGGCAGGAGGGAGG + Intergenic
1061495419 9:130971119-130971141 AAGGGAAGAAGGGAGGAGGGAGG + Intergenic
1061720725 9:132549535-132549557 CAGGGATGAAAGCAGGAGCTTGG + Intronic
1062050638 9:134444754-134444776 GAAGGAGAAAAGAAGGAGGGAGG - Intergenic
1062128689 9:134880859-134880881 CAGGAAAGAGAGCAGCAGGGTGG - Exonic
1062480954 9:136751086-136751108 GAGGGGAAGAAGAAGGAGGGAGG + Intergenic
1062702245 9:137913395-137913417 CAGGGAACCAGGCAGGAGGAAGG + Intronic
1203446734 Un_GL000219v1:63742-63764 AAAGGAAAAAAAAAGGAGGGAGG - Intergenic
1203583935 Un_KI270746v1:45132-45154 CAGGGAAATAAGGAGGACTGAGG + Intergenic
1185545400 X:939789-939811 AAGAGAAAAGAGGAGGAGGGGGG - Intergenic
1185611112 X:1394237-1394259 GATGGAGAAAAACAGGAGGGAGG - Intergenic
1185712814 X:2317594-2317616 AAGGGAAAAAAGCAGGCAGGAGG + Intronic
1185766839 X:2732498-2732520 AAGAGAGAAAAGAAGGAGGGAGG - Intronic
1186196693 X:7116425-7116447 CTGGGAAGAAACCAGGAGGCAGG - Intronic
1186330972 X:8533999-8534021 GAGGGAAGAATGAAGGAGGGAGG + Intronic
1186731576 X:12416185-12416207 AAGGGAAGAAAGGAGGAGGAAGG - Intronic
1186958354 X:14708001-14708023 CATGAAAGAAAGAAGGAGGGAGG - Intronic
1186962608 X:14752928-14752950 CAGAGAAGAAGGAAGGAGGGAGG - Intergenic
1187056709 X:15747501-15747523 GAGGAAAAATGGCAGGAGGGGGG + Intronic
1187163971 X:16787359-16787381 GAGGGGAAAAAAGAGGAGGGTGG - Intronic
1187356121 X:18573581-18573603 CAGGGAAAAGAGCATGACAGTGG - Intronic
1187598185 X:20798056-20798078 CAGGGAAAAGGGCAAGAGAGGGG - Intergenic
1187882913 X:23862944-23862966 CAGGGAAGGGAGAAGGAGGGAGG + Intronic
1187912104 X:24120559-24120581 AAGGAAAAAAAGAAGGAAGGAGG - Intergenic
1188239949 X:27773796-27773818 CAGTGAATGAAGCAGGATGGGGG - Intergenic
1188451386 X:30310729-30310751 CAGCAAAAAAAGAAAGAGGGAGG - Intergenic
1189224183 X:39398712-39398734 AAGGAAAAAAAGAGGGAGGGAGG - Intergenic
1189848168 X:45155492-45155514 CAGGGCAAAAATCATAAGGGTGG + Intronic
1190303914 X:49071876-49071898 CTGGGACAAGAGCAGGAGGCTGG - Exonic
1190894965 X:54608500-54608522 CGGGGGAAAGAGTAGGAGGGGGG - Intergenic
1192510229 X:71717000-71717022 CTGGGAAGAAACCAGCAGGGAGG - Exonic
1192516468 X:71764553-71764575 CTGGGAAGAAACCAGCAGGGAGG + Exonic
1192738901 X:73874670-73874692 CAGGGAAGAAATGAGGAGGGAGG + Intergenic
1193184483 X:78495990-78496012 GAGGGAAACAAGCATGAGGCAGG + Intergenic
1193344826 X:80393359-80393381 ACGGGAAAAAAGAAGGAGTGAGG - Intronic
1193540709 X:82768357-82768379 CAGGGAAAGAACTAGAAGGGAGG - Intergenic
1194268913 X:91785213-91785235 AAAGAAAAAAAGGAGGAGGGGGG - Intronic
1195285342 X:103377284-103377306 AAGGGGAGAAAGCTGGAGGGAGG + Intronic
1196392785 X:115226123-115226145 CAAGAGAAAAAGGAGGAGGGGGG + Intronic
1196792631 X:119478063-119478085 TAGGGAAAGAAGCTGCAGGGAGG + Intergenic
1197204303 X:123776719-123776741 CAAAGAAAAAAGCAGGTGAGGGG - Intergenic
1197230556 X:123999432-123999454 CAGGGAGAGAAGGGGGAGGGAGG - Intronic
1197630463 X:128852469-128852491 CAGGGAACAAAGAAGGACAGGGG + Intergenic
1197894855 X:131301977-131301999 CAATGAAAATAGCAGGATGGGGG + Intronic
1198075098 X:133186339-133186361 CAGGGAAAGGAGCAGGAAAGAGG + Intergenic
1198301578 X:135338923-135338945 GAGGAAGAATAGCAGGAGGGAGG - Intronic
1198732064 X:139742145-139742167 AGGGGAAAAAAGGAGGGGGGAGG + Intronic
1198801944 X:140457194-140457216 CAGGAAAAAAAGAGAGAGGGTGG - Intergenic
1199683393 X:150242979-150243001 CTGGGAGACAGGCAGGAGGGAGG + Intergenic
1200586128 Y:5006225-5006247 AAAGAAAAAAAGGAGGAGGGGGG - Intronic
1200831433 Y:7690941-7690963 CGGGGGAGAAACCAGGAGGGAGG + Intergenic
1201462390 Y:14240420-14240442 AAGGGAACAAAACAGGATGGAGG + Intergenic
1201528118 Y:14959412-14959434 CAGGAAGGAAGGCAGGAGGGAGG + Intergenic
1201701079 Y:16882896-16882918 GAGGGAAAAAAGGAGAAGGAAGG + Intergenic
1201715535 Y:17040887-17040909 CAGGGACAAACTCAGGTGGGAGG - Intergenic