ID: 919725237

View in Genome Browser
Species Human (GRCh38)
Location 1:200878169-200878191
Sequence TTGTAGCCATGGAGAGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919725229_919725237 -9 Left 919725229 1:200878155-200878177 CCCCATCCCAATCCTTGTAGCCA No data
Right 919725237 1:200878169-200878191 TTGTAGCCATGGAGAGGAGATGG No data
919725223_919725237 22 Left 919725223 1:200878124-200878146 CCTCAGGATTAGCTTGTTCCAGG No data
Right 919725237 1:200878169-200878191 TTGTAGCCATGGAGAGGAGATGG No data
919725230_919725237 -10 Left 919725230 1:200878156-200878178 CCCATCCCAATCCTTGTAGCCAT No data
Right 919725237 1:200878169-200878191 TTGTAGCCATGGAGAGGAGATGG No data
919725222_919725237 23 Left 919725222 1:200878123-200878145 CCCTCAGGATTAGCTTGTTCCAG No data
Right 919725237 1:200878169-200878191 TTGTAGCCATGGAGAGGAGATGG No data
919725228_919725237 -1 Left 919725228 1:200878147-200878169 CCGGGCTACCCCATCCCAATCCT No data
Right 919725237 1:200878169-200878191 TTGTAGCCATGGAGAGGAGATGG No data
919725227_919725237 4 Left 919725227 1:200878142-200878164 CCAGGCCGGGCTACCCCATCCCA No data
Right 919725237 1:200878169-200878191 TTGTAGCCATGGAGAGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919725237 Original CRISPR TTGTAGCCATGGAGAGGAGA TGG Intergenic
No off target data available for this crispr