ID: 919726964

View in Genome Browser
Species Human (GRCh38)
Location 1:200891027-200891049
Sequence CAGCCAGCGGGCCCGGCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 398}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919726956_919726964 -4 Left 919726956 1:200891008-200891030 CCTTCAGCCAGCCGGAGTTCAGC 0: 1
1: 0
2: 1
3: 9
4: 100
Right 919726964 1:200891027-200891049 CAGCCAGCGGGCCCGGCGGGAGG 0: 1
1: 0
2: 2
3: 26
4: 398
919726952_919726964 14 Left 919726952 1:200890990-200891012 CCGGGAGGGTGCTCCTTCCCTTC 0: 1
1: 0
2: 2
3: 24
4: 270
Right 919726964 1:200891027-200891049 CAGCCAGCGGGCCCGGCGGGAGG 0: 1
1: 0
2: 2
3: 26
4: 398
919726955_919726964 -3 Left 919726955 1:200891007-200891029 CCCTTCAGCCAGCCGGAGTTCAG 0: 1
1: 0
2: 0
3: 9
4: 91
Right 919726964 1:200891027-200891049 CAGCCAGCGGGCCCGGCGGGAGG 0: 1
1: 0
2: 2
3: 26
4: 398
919726954_919726964 1 Left 919726954 1:200891003-200891025 CCTTCCCTTCAGCCAGCCGGAGT 0: 1
1: 0
2: 0
3: 23
4: 175
Right 919726964 1:200891027-200891049 CAGCCAGCGGGCCCGGCGGGAGG 0: 1
1: 0
2: 2
3: 26
4: 398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919726964 Original CRISPR CAGCCAGCGGGCCCGGCGGG AGG Intronic
900086287 1:899310-899332 GAGCCACCGCGCCCGGCTGGGGG + Intergenic
900094810 1:936054-936076 CAGCCAGCGGGGCAGACAGGAGG + Intronic
900303973 1:1993568-1993590 GAGCCACCGTGCCCGGCCGGTGG + Intronic
900342534 1:2195603-2195625 CAGCCAGGGAGCCCTGCAGGAGG - Intronic
900375995 1:2355061-2355083 CAGGCAGTGGGGCCGGCGCGGGG + Intronic
900403999 1:2484518-2484540 CAGGTAGAGGTCCCGGCGGGTGG - Exonic
900502807 1:3014892-3014914 CAGCAAGCGGGGCCGGGAGGGGG + Intergenic
900629287 1:3625152-3625174 CAGGCGGCGGCCCGGGCGGGGGG + Exonic
901007775 1:6180059-6180081 CTGGCACCGCGCCCGGCGGGAGG - Exonic
901086964 1:6616309-6616331 GAGCCACCGCGCCCGGCGAGTGG + Intronic
901100354 1:6715103-6715125 CGGCCAGCCGCCCCGTCGGGAGG - Intergenic
901534204 1:9871927-9871949 CAGGCAGCGGGCCCCCAGGGAGG - Intronic
901573522 1:10181522-10181544 GAGCCACCGGGCCCGGCCTGAGG - Intergenic
901729811 1:11271249-11271271 GAGCCACCGCACCCGGCGGGAGG - Intergenic
901835931 1:11924177-11924199 GAGCCACCGCGCCCGGCGAGAGG - Intronic
902006337 1:13235240-13235262 GAGCCACCGCGCCCGGCCGGGGG + Intergenic
902467721 1:16628526-16628548 GCGCCAGCGGGACCGGCTGGAGG - Intergenic
902506860 1:16944202-16944224 GCGCCAGCGGGACCGGCTGGAGG + Exonic
902803954 1:18849316-18849338 CAGCCAGGGGGCCTGGTGGGTGG - Exonic
902917016 1:19645189-19645211 CAGGCCTCGGGGCCGGCGGGAGG - Intronic
903281219 1:22251040-22251062 CAGCTGGAGGGACCGGCGGGAGG - Intergenic
903569313 1:24292669-24292691 CAGCCACCGCGCCCGGCCAGTGG - Intergenic
903693876 1:25193314-25193336 CAGGCAGCGGGGCCGGGGGATGG + Intergenic
904688578 1:32276926-32276948 GAGCCACCGCGCCCGGCTGGAGG - Intronic
904762733 1:32817461-32817483 GAGCCAGTGGGCACGGTGGGCGG + Exonic
904834210 1:33324481-33324503 CAGCCAGCAGGCCTGGATGGAGG - Exonic
905066889 1:35192250-35192272 CGGCCGCCGGGCCCGCCGGGCGG + Exonic
905137056 1:35808127-35808149 CAGCGCGCGCGCCCGCCGGGAGG - Intergenic
907136344 1:52142468-52142490 CAGACCGCGGGCCGGGCGGACGG + Intronic
907843217 1:58176693-58176715 GAGCCACCGCGCCCGGCTGGAGG - Intronic
910450110 1:87335419-87335441 CAGCCAGAGCGCCCAGCCGGCGG + Intronic
910835208 1:91501359-91501381 CAGCCAGCGGGACCGCGTGGGGG - Intronic
912824748 1:112895029-112895051 CGGCCTGCGGCCCTGGCGGGGGG + Intergenic
915165599 1:153946315-153946337 CCGCCAGCGGGCCGGCCGGCCGG - Exonic
915237425 1:154494496-154494518 GAGCCACCGGGCCCGGCAGATGG + Intronic
915347508 1:155205244-155205266 CAGCAAGCGGGCCTGGCTGATGG - Exonic
916090540 1:161305332-161305354 CAGCCAGGGGGACAGGCTGGGGG + Exonic
916576349 1:166070390-166070412 GGGGCAGCGGGCCCGGCTGGTGG - Exonic
919726964 1:200891027-200891049 CAGCCAGCGGGCCCGGCGGGAGG + Intronic
920196048 1:204228087-204228109 CAGCATGCGGCCCCTGCGGGAGG + Exonic
920260578 1:204685416-204685438 CAGACGGCGCGCGCGGCGGGAGG - Intronic
921057663 1:211556136-211556158 CAGCCATCGCGCCCGGCTGCTGG + Intergenic
922767371 1:228163039-228163061 GAGCCAGTGGGCCCGGCCCGGGG + Intergenic
923119668 1:230978619-230978641 CAGCAGGAGGCCCCGGCGGGCGG - Exonic
923999228 1:239532293-239532315 GAGCCACCGCGCCCGGCTGGTGG + Intronic
924539796 1:244970478-244970500 CAGCCCGGGGTCGCGGCGGGCGG - Exonic
924701816 1:246462198-246462220 TACCCAGCAGGCCCCGCGGGAGG - Intronic
924701825 1:246462229-246462251 TACCCAGCAGGCCCCGCGGGAGG - Intronic
924701834 1:246462260-246462282 TACCCAGCAGGCCCCGCGGGAGG - Intronic
1062976672 10:1688598-1688620 CAGTCAGAAGGCCAGGCGGGGGG - Intronic
1063093637 10:2890242-2890264 CAGCCAGAGCGCCGGGCAGGTGG - Intergenic
1063376548 10:5557835-5557857 CAGCCAGGCAGCCCAGCGGGGGG - Intergenic
1064443133 10:15371155-15371177 CGGGCGGCGGGCCCGGCGCGCGG - Intergenic
1065099564 10:22320736-22320758 CAGCCCGCGGGGCCGGCCGGGGG + Intronic
1065367866 10:24952705-24952727 CCGCCGGCGGGCCCGGGGCGGGG - Intergenic
1066406715 10:35126235-35126257 GAGCCAGCGGGCCCAGCATGCGG + Intergenic
1067136982 10:43618243-43618265 GAGCCACCGCGCCCGGCCGGGGG - Intergenic
1067188386 10:44049457-44049479 CTGCCAGCAGGCCCAGCTGGAGG - Intergenic
1067842435 10:49691737-49691759 CAGTCAGCAGGCCCTGCAGGAGG + Intronic
1073648725 10:105336099-105336121 GAGCCACCGCGCCCGGCCGGTGG - Intergenic
1074591417 10:114817347-114817369 GAGCCACCGCGCCCGGCTGGAGG - Intergenic
1075754758 10:124801914-124801936 CCCCCAGCGGGCGCGGCAGGGGG - Intronic
1075754867 10:124802317-124802339 CAACCTGCGAGACCGGCGGGCGG - Intronic
1076318807 10:129563905-129563927 CATGCAGCGTGCCCGGCGGAAGG + Intronic
1076550992 10:131278084-131278106 AGGCCAGTGGGCCCGGGGGGAGG - Intronic
1076792756 10:132785731-132785753 CGGCCCGTGGGCGCGGCGGGCGG - Exonic
1076793583 10:132788537-132788559 CAGGCAGCGGGGCCGCCGGGCGG - Intergenic
1077073428 11:688536-688558 CAGCCAGAGAGCCCTGCTGGAGG - Intronic
1077413699 11:2414877-2414899 CAGGCCGCGGGCCCAGCGCGGGG - Intronic
1077503580 11:2920072-2920094 CAGCCAGAGTGCGGGGCGGGGGG + Intronic
1078202055 11:9192342-9192364 GAGCCACCGCGCCCGGCCGGGGG - Intronic
1078801073 11:14644312-14644334 CAGCCAGGGCGCCCAGCGAGAGG - Exonic
1079592016 11:22192944-22192966 GAGCCAGCCGGGCCGGGGGGCGG + Intergenic
1080036750 11:27719411-27719433 CAGAGAGCGGGCCGGGCGAGGGG - Intronic
1080887706 11:36381872-36381894 GAGCCACCGCGCCCGGCTGGTGG - Intronic
1082188056 11:49208347-49208369 CAGCCAGCGCGGGCGGCGCGCGG + Exonic
1083753671 11:64777995-64778017 CAGCAGCCGGGCCCGGCCGGCGG - Exonic
1084378697 11:68796827-68796849 CAGACAGCAGCCCGGGCGGGTGG + Intronic
1085093532 11:73739770-73739792 GAGCCACCGGGCCCGGCCTGAGG - Intronic
1085559702 11:77459978-77460000 GAGCCACCGCGCCCGGCGTGGGG + Intronic
1088462102 11:110093056-110093078 CGGCCAGCTGTCCGGGCGGGAGG + Intergenic
1088858014 11:113773573-113773595 CAGCCGCCTGACCCGGCGGGTGG - Exonic
1089346572 11:117795399-117795421 CAGCCTGCGGGGGCGGAGGGAGG + Intronic
1089432550 11:118436235-118436257 CAGGTTGCGGGGCCGGCGGGCGG + Intergenic
1089729533 11:120511717-120511739 CTGCGAGCGAGCCCGGCGCGGGG - Intergenic
1089733237 11:120532538-120532560 CAGCCAGCCGGCTCAGAGGGAGG - Intronic
1089827559 11:121292729-121292751 CAGCAAGCGGGCCGGGAGGCTGG - Exonic
1090056681 11:123430400-123430422 CAGCCAGGGGCCCCAGGGGGCGG - Exonic
1090741009 11:129660210-129660232 GAGCCACCGCGCCCGGCCGGCGG - Intergenic
1090803887 11:130190548-130190570 CTGCCAGTGGGCCCTGCGGGGGG + Exonic
1090964375 11:131585317-131585339 CTGCCAGCTGGCCTGGCTGGGGG + Intronic
1090972177 11:131653364-131653386 CAGCCGGAGGGCCCTGGGGGAGG + Intronic
1091122016 11:133064742-133064764 CAGCCACACGGCCCGGCGCGGGG + Intronic
1091584723 12:1809680-1809702 CAGCCAGCGGGGGCGGGGGGAGG + Intronic
1092852505 12:12643182-12643204 CAGCTAGTGGGCCTGGCTGGGGG + Exonic
1093466981 12:19459513-19459535 GAGCCACCGCGCCCGGCCGGGGG + Intronic
1094624093 12:32106704-32106726 CGGCCCGCGCGCCCGGCGGGAGG + Intergenic
1095439500 12:42227759-42227781 CAGCACGCTGGCCAGGCGGGGGG - Intronic
1095581576 12:43806283-43806305 CAGCCAGCGGCCCCGGCCGGCGG + Intronic
1096951577 12:55479167-55479189 AGGGCAGCTGGCCCGGCGGGCGG + Intergenic
1097425203 12:59436078-59436100 CAGCAGGCGGGGCCGGTGGGAGG - Intergenic
1099236891 12:80092974-80092996 GAGCCACCGGGCCCGGCCGGTGG + Intergenic
1102277135 12:111591171-111591193 GAGCCACCGTGCCCGGCCGGTGG + Intronic
1102300170 12:111765983-111766005 GAGCCACCGCGCCCGGCGGTGGG - Intronic
1102911473 12:116717715-116717737 CAGCCATCGGGCCAGGCTGCAGG - Exonic
1103464767 12:121133219-121133241 CAGCCAGCTGGGCGGGAGGGAGG + Intronic
1104729718 12:131098128-131098150 CAGACAGCGGCCACCGCGGGAGG - Intronic
1105745753 13:23375611-23375633 CAGCTAACGGTCCCGGCGGGTGG - Intronic
1105913923 13:24894954-24894976 AAGCCAGCAGGCCTGGCTGGCGG + Intronic
1108330341 13:49378431-49378453 CGGCCAGCCGCCCCGTCGGGAGG + Intronic
1114259100 14:21024966-21024988 GCGCCAGCCGGGCCGGCGGGCGG - Intronic
1116886935 14:50231315-50231337 CAGCCCGCGGGCCGGGCCGGTGG + Exonic
1117647671 14:57868746-57868768 GAGCCACCGTGCCCGGCGGAAGG + Intronic
1118955628 14:70477780-70477802 CGGCCAGCCGCCCCGCCGGGAGG + Intergenic
1119300827 14:73569972-73569994 TAGCCCGGGGGCGCGGCGGGGGG - Intronic
1119319087 14:73718869-73718891 CCACCAGCAGGCCCTGCGGGAGG - Exonic
1119407483 14:74407625-74407647 TAGGAAGAGGGCCCGGCGGGAGG + Exonic
1119483322 14:74973398-74973420 CAGCCACCGTGGCCAGCGGGAGG - Intergenic
1121287327 14:92746750-92746772 GAGCCACCGCGCCCGGCTGGTGG - Intronic
1122082505 14:99275066-99275088 CAGACAGCAGGCGGGGCGGGAGG + Intergenic
1122144940 14:99683694-99683716 CAGCCCGCGGGCCCCGCTGGCGG + Intergenic
1122214350 14:100193315-100193337 AGGCCAGGGGGCCTGGCGGGAGG - Intergenic
1122620741 14:103056655-103056677 CAGGGCGAGGGCCCGGCGGGGGG + Intronic
1122636375 14:103131684-103131706 CACCCAGGGGGCCCAGCAGGAGG - Exonic
1122688775 14:103521992-103522014 CTGCGGGCGGGCCGGGCGGGCGG - Intronic
1122902343 14:104787041-104787063 CAGTCACCGGGCCCGCCTGGGGG + Intronic
1122959633 14:105088456-105088478 CAGCCAGCGGGGCCGAGGGGAGG + Intergenic
1124049135 15:26178827-26178849 CAGCCAGCGATCCAGGAGGGGGG - Intergenic
1124439245 15:29674944-29674966 AAGCCAGCGGGGCTGGCGGAGGG - Intergenic
1125297824 15:38221879-38221901 GAGCCACCGCGCCCGGCCGGAGG + Intergenic
1125535842 15:40441006-40441028 CAGGCAGCCGGACGGGCGGGCGG - Intronic
1125541260 15:40471222-40471244 CCGCCAGCGGGGTCAGCGGGCGG - Exonic
1126407110 15:48332287-48332309 CAGTAAGCGGGCCCGGCCTGCGG + Exonic
1127083106 15:55399807-55399829 GAGCCAACGGGCCCGGCCTGTGG - Intronic
1127522406 15:59755666-59755688 GAGCCACCGCGCCCGGCCGGGGG + Intergenic
1128104723 15:65035110-65035132 GAGCCACCGTGCCCAGCGGGTGG - Intergenic
1128467678 15:67926568-67926590 GAGCCACCGTGCCCGGCGAGAGG + Intergenic
1129675948 15:77632542-77632564 GAGGCCGCGGCCCCGGCGGGCGG + Intronic
1130076602 15:80695293-80695315 CAGCCCGCCCGCCCGGCGGCAGG - Exonic
1130076628 15:80695388-80695410 CAGCCAGCCAGCCGGGCCGGCGG + Exonic
1130076631 15:80695392-80695414 CAGCCAGCCGGGCCGGCGGCGGG + Exonic
1131398392 15:92104951-92104973 CAGCCACCGCGCCCGGCTGGAGG - Intronic
1132052454 15:98618283-98618305 GAGCCACCGCGCCCGGCCGGTGG + Intergenic
1132597641 16:760629-760651 CAGGCAGCGGGCCAGGCCTGGGG - Intronic
1132853149 16:2033710-2033732 GAGCCCGAGGGCCTGGCGGGAGG + Intronic
1132875811 16:2136390-2136412 GAGCCAGCGGGTGCGTCGGGAGG - Intergenic
1132895690 16:2228457-2228479 CTGCCAGCGGGCCCCTCCGGAGG + Exonic
1132912079 16:2319199-2319221 GAGCCACCGTGCCCGGCCGGAGG - Intronic
1132958785 16:2610921-2610943 CTTCCTGCGGGCCCGGCGTGAGG - Intergenic
1132973287 16:2699295-2699317 CAGCAAGCGTGCCAGGCAGGTGG + Intronic
1132983587 16:2752104-2752126 CAGCCAGCGGGCACCCCCGGAGG - Intergenic
1133183316 16:4075743-4075765 CAGCGGGGGGGCCAGGCGGGAGG + Intronic
1134070353 16:11256371-11256393 CGGGCAGAGGGCCCCGCGGGAGG - Intronic
1134519171 16:14910943-14910965 GAGCCAGCGGGTGCGTCGGGAGG + Intronic
1134554757 16:15155283-15155305 GAGCCAGCGGGTGCGTCGGGAGG - Intergenic
1134706841 16:16309598-16309620 GAGCCAGCGGGTGCGTCGGGAGG + Intergenic
1134960699 16:18402526-18402548 GAGCCAGCGGGTGCGTCGGGAGG - Intergenic
1136611510 16:31369263-31369285 GAGGCAGCTGGCCGGGCGGGGGG + Intronic
1138043586 16:53698640-53698662 CGGCCAGCCGCCCCGTCGGGAGG + Intronic
1138619045 16:58197595-58197617 GGATCAGCGGGCCCGGCGGGGGG + Intronic
1140406767 16:74716631-74716653 CAGCCAGGGGCCCCGGCAGCTGG + Intronic
1141194899 16:81853044-81853066 GAGCCAGCGGGCCCAGCCTGGGG - Intronic
1141715520 16:85724699-85724721 CAGCCACCCCGGCCGGCGGGAGG + Intronic
1142057488 16:88007433-88007455 CAGGCCGAGGGCCAGGCGGGAGG - Intronic
1142188510 16:88706258-88706280 CCGCCGGCCGGGCCGGCGGGCGG - Exonic
1142188511 16:88706258-88706280 CCGCCCGCCGGCCCGGCCGGCGG + Exonic
1142362102 16:89632335-89632357 GAGCCACCGCGCCCGGCCGGGGG + Intronic
1142407926 16:89901459-89901481 GAGCCACCGCGCCCGGCCGGAGG - Intronic
1142408026 16:89901931-89901953 GAGCCACCGCGCCCGGCCGGAGG - Intronic
1142408126 16:89902403-89902425 GAGCCACCGCGCCCGGCCGGAGG - Intronic
1142480516 17:215746-215768 CAGAGAGGTGGCCCGGCGGGTGG + Exonic
1142670704 17:1486201-1486223 CGGCCGGCGCGCCCGGCGGGCGG + Intronic
1142762402 17:2050185-2050207 CAGGCAGCGGGCCGGGGGCGGGG + Intergenic
1142763747 17:2055146-2055168 CCGACCGGGGGCCCGGCGGGCGG + Intronic
1143013496 17:3879307-3879329 CAGCCAGCTGGCCAGGGAGGAGG - Intronic
1143106104 17:4531334-4531356 CAGCCTGGGGGCCCCGAGGGCGG - Intronic
1143496397 17:7315171-7315193 CGGCGAGCGGGCCGGGCGGACGG - Intronic
1144269212 17:13601200-13601222 CAGCGCGCTGGCCCGCCGGGGGG - Exonic
1144483939 17:15649568-15649590 CAGTCACCGTGCCCGGCTGGTGG + Intronic
1144516185 17:15918916-15918938 CAGCCAGAGGCCCAGGCAGGAGG + Intergenic
1146012120 17:29204512-29204534 CAGCCAGCGGCCCCGGCCGGCGG + Intergenic
1146510478 17:33443698-33443720 GAGCCACCGCGCCCGGCCGGAGG + Intronic
1146703261 17:34980671-34980693 AAGGCAGCGGGCCCGGGGCGAGG + Intronic
1146941654 17:36847641-36847663 CAGCCAGCGGGAACGGCCAGGGG - Intergenic
1147677711 17:42219275-42219297 CGGCCAGCGGGCAGGGCAGGAGG - Intronic
1147688325 17:42300296-42300318 CGGCCAGCGGGCAGGGCAGGAGG + Intronic
1147987575 17:44315328-44315350 ACGCCGGCGGGCCCGGGGGGCGG + Intronic
1148151007 17:45396415-45396437 CAGCCTGCGGTCCTGGCAGGAGG + Intronic
1148497100 17:48059590-48059612 CGACCAGCAGGCCCGGCGGCAGG + Exonic
1149296233 17:55264879-55264901 GGGCGAGCGGGCCAGGCGGGCGG + Intergenic
1149541402 17:57470728-57470750 CAGCCAGCAGCTCCTGCGGGTGG + Intronic
1149558734 17:57593185-57593207 AAGTCAGCAGGCCTGGCGGGAGG + Intronic
1151401368 17:73858000-73858022 CAGCGAGGGGGCCCTGAGGGAGG - Intergenic
1151662405 17:75525755-75525777 GAGCGAGCGGGGCCGGCGGCGGG + Exonic
1151873013 17:76849371-76849393 GAGCCACCGCGCCCGGCTGGAGG + Intergenic
1151918913 17:77139780-77139802 GAGCCACCGCGCCCGGCCGGTGG + Intronic
1152155345 17:78629281-78629303 CCAGCAGCTGGCCCGGCGGGAGG - Intergenic
1152552199 17:81035403-81035425 CAGCCTCCTGGCCCGGCGCGCGG - Intronic
1152754501 17:82081619-82081641 CAGCCAGCGGGACCTGGTGGAGG - Exonic
1152809539 17:82375059-82375081 CTTCAAGCGGGCCCGGCGGCCGG + Exonic
1153382597 18:4455371-4455393 CAACCACCGGAGCCGGCGGGCGG + Intergenic
1154241531 18:12657838-12657860 CAGGCGGCTGGCCCGGCGGGCGG - Exonic
1154409290 18:14128003-14128025 AAGCCACCGCGCCCGGCTGGTGG - Intronic
1157595097 18:48859560-48859582 CAGCCAGGGGGCCTGGCAGGCGG + Exonic
1158954151 18:62523569-62523591 CCGCCCGCGGGCCCGTCGCGGGG + Exonic
1160860486 19:1235426-1235448 CAGCCCGAGGGGGCGGCGGGTGG + Intronic
1160904543 19:1446154-1446176 CAGTCCGCGGGCCCGGGGCGGGG - Intergenic
1160947974 19:1652283-1652305 CAGCAGGTGAGCCCGGCGGGGGG - Exonic
1161008998 19:1950991-1951013 CAGAGAGCTGGCCAGGCGGGTGG + Intronic
1161124793 19:2549766-2549788 CAGCCAGCAGGCCGGGGGTGAGG + Intronic
1161424400 19:4194827-4194849 CAGCCAGTGGGCTTGGCCGGTGG + Intronic
1161479709 19:4504430-4504452 GAGCCTGCAGGCCCGGCGCGGGG - Exonic
1161658315 19:5529694-5529716 CAGCCAGCTGGCCAGGGAGGCGG + Intergenic
1161959528 19:7516151-7516173 CCGCCGGCGGGGCTGGCGGGCGG + Exonic
1162032953 19:7925228-7925250 CAGAGGGCCGGCCCGGCGGGGGG - Exonic
1162084528 19:8240536-8240558 CAGGCAGCGGGCCAGGCTGCAGG + Intronic
1163551155 19:17967116-17967138 CAGTCCACGGGCCCGGCGGGGGG - Intronic
1165063763 19:33217672-33217694 CCCCCTGCGGGCCCGGCAGGTGG - Intronic
1165745714 19:38228796-38228818 CAGCCACCGGGCCCGGGAAGAGG + Intronic
1166966580 19:46532866-46532888 GAGCCACCGTGCCCGGCTGGTGG + Intronic
1167348585 19:48961869-48961891 CAGACGGCGGGCCCGGCGTGGGG - Intergenic
1167357319 19:49011964-49011986 CAGCCAGCGGGCATGGTGGCAGG - Intronic
1167418824 19:49390890-49390912 CTGCCCGAGGGCCCGGTGGGTGG + Exonic
1167880245 19:52451516-52451538 CAGCCAGCGGGCCCAGCCCGCGG + Intronic
1168293914 19:55369755-55369777 CGGCTGGCGGGCCCGGGGGGCGG - Intronic
1168309881 19:55455087-55455109 CAGCCAGGTGGACCGGCTGGTGG - Exonic
1168353849 19:55690484-55690506 CAGCCAGCGGGCCCGTCACAGGG - Intronic
1168409066 19:56127365-56127387 CAGACAGCGGGCCAGGCCTGGGG - Intergenic
924987952 2:288322-288344 CGGCCGCCGGGCCCGGCGCGCGG - Intronic
925379879 2:3417327-3417349 CAGGCAGCGGGGGCGGTGGGGGG - Intronic
926101725 2:10122459-10122481 CAGCCAGCGGACGGGCCGGGGGG + Exonic
926144178 2:10386763-10386785 CAGGCAGCGGGGCTGGTGGGGGG - Intronic
926215509 2:10902983-10903005 CAGCCAGCCGTCCGGGAGGGAGG - Intergenic
926247275 2:11130747-11130769 GAGCCACCGCGCCCGGCTGGAGG - Intergenic
927863742 2:26576084-26576106 CAGCCAGCGGTCCCGGGTGCTGG - Exonic
928456964 2:31431054-31431076 CAGCCAGCAGGCACAGTGGGTGG + Intergenic
929110793 2:38403768-38403790 CGGGCAGCTGGCCGGGCGGGGGG - Intergenic
932042873 2:68319092-68319114 CTCCCAGCGGGCCCGGGGGTTGG - Intronic
933965213 2:87427020-87427042 CAGCCAGCCAGCCAAGCGGGGGG + Intergenic
934949383 2:98566050-98566072 CAAACAGCGGGCCCGGCAGAGGG - Exonic
937125891 2:119474797-119474819 CAGGAAGAGGGCCCGGTGGGTGG - Intronic
937311851 2:120907598-120907620 CAGCCAGTGGGCAGGGCAGGTGG + Intronic
938131387 2:128718492-128718514 CTGGCAGAGTGCCCGGCGGGGGG - Intergenic
940208045 2:151225813-151225835 GAGCCACCGCGCCCGGCCGGGGG - Intergenic
942046395 2:172101704-172101726 CTCCTAGAGGGCCCGGCGGGGGG + Intronic
942890462 2:180980946-180980968 GCGCGAGCGGGCCGGGCGGGCGG + Exonic
946040038 2:216775302-216775324 CAGACAGCTGGCCTGGCTGGGGG + Intergenic
947226704 2:227847577-227847599 GAGCCACCGCGCCCGGCCGGAGG - Intergenic
947425956 2:229983089-229983111 GAGCCACCGCGCCCGGCAGGAGG - Intronic
948464552 2:238145950-238145972 CAGACAGCGAGCCCTGAGGGTGG - Intronic
948729498 2:239953995-239954017 CACTCAGCGGTCCCGGCAGGGGG - Intronic
948786675 2:240356272-240356294 GAGCCCGTGGGCCTGGCGGGTGG + Intergenic
1170524827 20:17227086-17227108 CAGTCAGGCGGCCCGGCGCGCGG - Exonic
1171311786 20:24150666-24150688 CAGCTAGCGGGCCCTGTGTGGGG - Intergenic
1171402056 20:24880070-24880092 CAGCCAGCTGGCCCAGCCGCTGG + Intergenic
1172279432 20:33699570-33699592 GAGGCAGCTGGCCGGGCGGGGGG - Intergenic
1173221669 20:41137188-41137210 CAGGCCGCAGGCCCGGCGGCCGG - Intronic
1173279733 20:41617974-41617996 CCGGCCGCGGGCCTGGCGGGCGG - Intronic
1173868872 20:46329754-46329776 CAGCCAGGGAGCCCGGCATGGGG - Intergenic
1173962898 20:47088861-47088883 AAGTCAGGGGGCCCGGCGTGGGG - Intronic
1174042772 20:47711509-47711531 CAGCCAGATGGCCCGTCGTGGGG - Intronic
1175435027 20:58940373-58940395 GAGCCAGCGCGCCCGGCCAGGGG - Intergenic
1175801336 20:61802708-61802730 CAGCCTGGGGGCCGGGCAGGGGG + Intronic
1176001516 20:62833685-62833707 GAGCCACCGCGCCCGGCCGGGGG + Intronic
1176173798 20:63708263-63708285 AAGGCGGCGGGCGCGGCGGGTGG + Intronic
1177303474 21:19282013-19282035 GAGCCACCGCGCCCGGCGGAAGG - Intergenic
1178104008 21:29298898-29298920 AAGCGAGAGCGCCCGGCGGGCGG - Intronic
1179896976 21:44368714-44368736 GAGCCACCGTGCCCGGCCGGAGG + Intronic
1181052137 22:20242982-20243004 CAGCCTGCAGGCCCTGCTGGGGG + Exonic
1181120783 22:20667811-20667833 CAGCCAGCGCGCCTAGCGGCGGG - Intergenic
1182796927 22:32997740-32997762 GAGCCACCGCGCCCGGCCGGTGG - Intronic
1183244545 22:36683851-36683873 CAGCCAGGGGTCGCGGGGGGTGG - Intronic
1183328568 22:37207339-37207361 GCGCCAGCGGGCCGAGCGGGTGG + Exonic
1183445308 22:37849593-37849615 CAGCCTGAGGGCCGGGCGGGAGG - Intronic
1184126606 22:42491799-42491821 GAGCCACCGCGCCCGGCCGGTGG + Intergenic
1184209875 22:43029145-43029167 GAGCCACCGCGCCCGGCCGGGGG + Intergenic
1184989630 22:48158138-48158160 CAGACAGCAGGCCTGGGGGGAGG - Intergenic
1185340212 22:50287666-50287688 GAGCCGGCGGGCCCAGGGGGAGG - Exonic
1185402245 22:50625225-50625247 CAGCCAGGTGGCCCGGGGCGAGG - Exonic
1185417884 22:50720136-50720158 CAGCCAGGGCGCTGGGCGGGGGG - Intergenic
950415411 3:12866435-12866457 GAGCCACCGCGCCCGGCCGGGGG - Intronic
951661644 3:25072980-25073002 GAGCCACCGCGCCCGGCCGGAGG + Intergenic
951699683 3:25482824-25482846 CAGCTAGAGGGCTAGGCGGGTGG - Intronic
953404759 3:42654762-42654784 CGGCCCGCGGGCCCGGGTGGAGG + Intronic
954632500 3:52055152-52055174 CTGGCAGCGGGGCGGGCGGGAGG - Intronic
954699747 3:52445068-52445090 CGGCCAGCGGGACCAGAGGGCGG - Intronic
955281051 3:57595662-57595684 GAGCCACCGCGCCCGGCCGGAGG - Intronic
956414347 3:69012108-69012130 CAGCCAGAAGGCCTGGCCGGTGG + Intronic
956678030 3:71753684-71753706 GCGGCGGCGGGCCCGGCGGGGGG + Intronic
959024176 3:101221369-101221391 CAGACAGGGGGTGCGGCGGGGGG + Intergenic
961381327 3:126498191-126498213 AAGCCAGCGGGCCCAGGGTGAGG - Intronic
961552411 3:127676872-127676894 CAGCCAGGTGGCCAGGTGGGAGG + Intronic
961821388 3:129577404-129577426 CAGCCAGGGGGCTGGGTGGGTGG - Intronic
963648316 3:147945099-147945121 AAGCCACCGCGCCCGACGGGAGG + Intergenic
965265494 3:166537735-166537757 GAGCCACCGCGCCCGGCCGGCGG - Intergenic
965590331 3:170356743-170356765 CCGCCATCGGGCCGGGCGGGAGG - Intergenic
966015349 3:175132451-175132473 CAGCCAGCCGCCCCGTCCGGAGG - Intronic
966711931 3:182980450-182980472 CAGCCGGCAGGGCGGGCGGGCGG + Intronic
968491030 4:890546-890568 CTGCCAGCGGGGCCCACGGGAGG + Exonic
968845644 4:3040154-3040176 GAGCCAGCGTGCCCGGCCAGGGG - Intronic
968876100 4:3268768-3268790 CAGCCAGCGGGCGGGGTGGCAGG + Intronic
968965562 4:3767525-3767547 CGGCGAGCGGGCGCGGAGGGGGG + Exonic
969421853 4:7102190-7102212 AAGGGAGAGGGCCCGGCGGGAGG - Intergenic
971207349 4:24583881-24583903 CAGCCAGAGGGGCCGTGGGGAGG - Intronic
972543144 4:40056691-40056713 CAGCCGGCGGGCTTGGGGGGGGG + Intergenic
973675108 4:53255819-53255841 CGGGCAGCTGGCCGGGCGGGGGG + Intronic
978595132 4:110369182-110369204 CAGGCAGCAGGCCCGGCTGCAGG + Intronic
978662037 4:111138122-111138144 GAGCCACCGCGCCCGGCCGGAGG - Intergenic
982784653 4:159524312-159524334 GAGACAGCTGGCCGGGCGGGGGG - Intergenic
983238779 4:165207990-165208012 CAGCCGCCGGGGCCGGCGGGAGG + Intronic
983390551 4:167125427-167125449 GAGCCACCGCGCCCGGCCGGGGG - Intronic
983622358 4:169774619-169774641 CAGCCAGCGGTCACGAAGGGAGG + Intergenic
984002597 4:174268718-174268740 GAGCCACCGCGCCCGGCCGGGGG + Intronic
984191093 4:176606699-176606721 CAGGCAAGGGGACCGGCGGGAGG + Intergenic
984778384 4:183504205-183504227 GAGCCCGAGGGCCCGGCAGGAGG + Intergenic
985472516 5:54440-54462 CTGCCCGTGGGCCCGGCGGTGGG - Intergenic
986042119 5:4003913-4003935 CAGGGAGCGGGCCCGTGGGGAGG - Intergenic
986518355 5:8586849-8586871 GAGACAGCGGGCCTGGCAGGTGG - Intergenic
986631508 5:9778162-9778184 GAGCCACCACGCCCGGCGGGAGG + Intergenic
987132416 5:14871870-14871892 CCGCCAGCGGCCCCGGGGGCGGG + Intergenic
987193314 5:15500574-15500596 CAGCTAACGGTCCCGTCGGGCGG + Exonic
987258299 5:16179593-16179615 CCGCCAGCCGGGCCGGCAGGAGG - Exonic
989185807 5:38624741-38624763 GAGCCACCGCGCCCGGCGGCTGG + Intergenic
989625771 5:43428353-43428375 CAGGCAGCAGGCCCTGCAGGAGG - Intergenic
992443252 5:76813056-76813078 GAGGCAGCTGGCCGGGCGGGGGG - Intergenic
992611212 5:78510059-78510081 GAGCCGGCGGGCCCGGGCGGGGG - Exonic
995884201 5:116875549-116875571 GAGCCACCGTGCCCGGCTGGTGG + Intergenic
996422494 5:123277962-123277984 GAGCCACCGCGCCCGGCCGGGGG + Intergenic
997303379 5:132822645-132822667 GAGCCACCGCGCCCGGCTGGAGG + Exonic
999604078 5:153296727-153296749 GGGCCAGCTGGCCGGGCGGGGGG + Intergenic
1001559567 5:172660226-172660248 CAGTCAGGGGGCCCGGCAGAGGG + Intronic
1002634565 5:180600722-180600744 CAGCCAGCGAGCGGGGAGGGAGG - Intergenic
1003083043 6:3037643-3037665 CATCCAGGGGGCCCTACGGGTGG - Intergenic
1003212393 6:4079269-4079291 CGTCCCGCGGGCCCGGCGGCCGG - Exonic
1003290862 6:4776871-4776893 CGGCGAGCGGGGCCGTCGGGCGG - Intronic
1005960840 6:30691903-30691925 GAGCCACCGCGCCCGGCGAGAGG - Intergenic
1006346275 6:33485704-33485726 CAGCCAGCCGCCCCGTCCGGGGG - Intergenic
1006622596 6:35376734-35376756 GAGCCACCATGCCCGGCGGGAGG - Intronic
1006881840 6:37346995-37347017 GAGCCACCGTGCCTGGCGGGGGG - Intergenic
1007327459 6:41073220-41073242 CGGCCAGCGGCCCCGGCCCGGGG + Intronic
1007821041 6:44561012-44561034 CAGCCCCAGGGCCAGGCGGGTGG + Intergenic
1008554748 6:52664155-52664177 GAGGCTGCGGGCTCGGCGGGCGG + Intergenic
1009566540 6:65318149-65318171 GAGCCACCGCGCCCGGCTGGAGG + Intronic
1010204987 6:73314748-73314770 CAGGCACTGGGCCCGGCGGCGGG + Intergenic
1010319405 6:74488920-74488942 GAGGCAGCTGGCCGGGCGGGGGG - Intergenic
1010386321 6:75284676-75284698 CAGCCGGCGGGCCCCCTGGGTGG - Exonic
1015672548 6:135706655-135706677 CAGGCAGGGGGCCTGGTGGGAGG + Intergenic
1017296969 6:152808657-152808679 GAGCCACCGCGCCCGGCGAGAGG + Intergenic
1017873031 6:158502558-158502580 CAGCCAGCTGGCCCAGGGGCGGG + Exonic
1018319621 6:162593663-162593685 GAGCCAGCGGGCCCAGAGGAAGG + Intronic
1019100141 6:169623526-169623548 AAGCCTGCGGGCCCGGTGAGTGG - Intronic
1019279182 7:191926-191948 CCCCCAGCGGGCCCGGCGCCTGG + Intergenic
1019453094 7:1109758-1109780 CTGCCCCAGGGCCCGGCGGGCGG - Intronic
1019557838 7:1641406-1641428 CAGCCAGCTCGCCCGGCTGCAGG + Intergenic
1019984012 7:4642038-4642060 CAGCCAGCAGTCCCCGAGGGTGG - Intergenic
1020815542 7:12900971-12900993 GAGCCACCGTGCCCGGCCGGTGG + Intergenic
1022427889 7:30285325-30285347 CAGCGCGCGGGCCCGGCCCGGGG + Exonic
1022534268 7:31086047-31086069 CAGCCAGAGGACCCTGCAGGAGG - Intronic
1024049432 7:45609452-45609474 GAGCCAGAGGGCGCGGTGGGAGG + Intronic
1024558984 7:50627932-50627954 CAGCCTGGGAGCCCAGCGGGTGG - Intronic
1024580881 7:50799894-50799916 CAGCCAGAGTGCCCGGGGGAGGG - Intergenic
1025103126 7:56151163-56151185 GAGGCAGCTGGCCGGGCGGGGGG - Intergenic
1025261661 7:57424539-57424561 CTGCGCGCGGGCGCGGCGGGAGG - Intergenic
1026084146 7:67249019-67249041 GAGCCACCGCGCCCGGCGCGGGG + Intergenic
1026234164 7:68511363-68511385 CAGCCAGCTGGCAAGGCGGTGGG - Intergenic
1026843259 7:73682862-73682884 GCGCCTGAGGGCCCGGCGGGAGG - Exonic
1027190799 7:75994540-75994562 CGCCCAGCGGGCCCGGGGGCGGG + Exonic
1028158291 7:87457132-87457154 GAGCCACCGGGCCTGGCGGGGGG - Intronic
1028417694 7:90596804-90596826 CTGCCAGCGGGGCTGGCGTGGGG + Intronic
1029448266 7:100626892-100626914 CAGCCCGCGGGCCTGGGGTGGGG + Exonic
1029701404 7:102248870-102248892 CAGCGAGCTGGGCCTGCGGGGGG - Exonic
1030092819 7:105872868-105872890 GAGCCACCGTGCCCGGCGGGTGG - Intronic
1030260934 7:107563658-107563680 AAGCCAGGGGGCCGGGCGGAGGG + Intronic
1030502733 7:110380423-110380445 CAGCCAGTTGGCCCGGTGTGGGG - Intergenic
1033050021 7:137995615-137995637 CAGCCACCGCGCCCGGCCAGGGG + Intronic
1034349821 7:150408400-150408422 CAGCCAGAGGGTCCCGAGGGAGG - Intronic
1035620192 8:1030815-1030837 CAGCCAGCGGGGCCGCGGGCGGG + Intergenic
1036849286 8:12190492-12190514 CAGCCAGCAGGCGCTGCGGACGG - Intronic
1036870646 8:12432766-12432788 CAGCCAGCAGGCGCTGCGGACGG - Intronic
1036950242 8:13133304-13133326 CAGCGGGAGGGCCCGGCTGGCGG - Intronic
1037620882 8:20562461-20562483 GAGCCACGGGGCCGGGCGGGGGG - Intergenic
1037971790 8:23177042-23177064 CAGCCAGAGGACCCCCCGGGAGG + Intergenic
1038779096 8:30555908-30555930 CGGGCAGCCGGCCCGGTGGGGGG - Intronic
1039892928 8:41696805-41696827 CATCCAGCTGGCCCGGGAGGAGG - Intronic
1040545801 8:48397018-48397040 CGGTCAGCGGGGCTGGCGGGCGG - Intergenic
1040785498 8:51159249-51159271 GAGGCAGCTGGCCGGGCGGGGGG - Intergenic
1041693624 8:60714164-60714186 CGGCGAGCGGGCCCCCCGGGGGG + Intronic
1041792570 8:61714091-61714113 CATTCGGCGGGCCTGGCGGGCGG - Intronic
1047038957 8:120971328-120971350 GAGCCACCACGCCCGGCGGGAGG - Intergenic
1049109615 8:140635150-140635172 CAGCCCGCGGGCCCCGGGCGGGG + Intronic
1049157197 8:141074407-141074429 CAGCCAGCAGGCCAAGGGGGTGG - Intergenic
1049245888 8:141562347-141562369 CAGCCAGTGGGCATGGTGGGAGG - Intergenic
1049442162 8:142614508-142614530 CAGCCAGCGAGGCCCGTGGGCGG + Intergenic
1049596405 8:143485871-143485893 CAGCCAGCGGGATGGGCGTGAGG + Intronic
1049664665 8:143837595-143837617 CAGCAGGCCGGCCCGGGGGGTGG - Intronic
1049786662 8:144454167-144454189 CAGGCAGGGAGCCCAGCGGGAGG - Intronic
1049788519 8:144462599-144462621 GAGCCCGCGGGCCCCGCGGCCGG + Intronic
1049788545 8:144462657-144462679 CGGCCGGCCGGCCCGGCGGGCGG + Intronic
1052996729 9:34555195-34555217 CGGGCAGCTGGCCAGGCGGGAGG + Intronic
1053001216 9:34578142-34578164 CCCACAGCGGTCCCGGCGGGCGG + Intronic
1053519743 9:38765542-38765564 CAGACAGCCGGCCAGGCGCGGGG + Intergenic
1055030646 9:71768988-71769010 CGGGGAGCGGGGCCGGCGGGAGG - Intronic
1055586277 9:77761558-77761580 GAGGCAGCTGGCCGGGCGGGGGG - Intronic
1056071698 9:82993809-82993831 CAGCCAGTGGGTCCAGCTGGTGG - Intronic
1058937202 9:109780271-109780293 CAGCCAGGCGGCCGGGAGGGCGG + Intronic
1059277699 9:113109610-113109632 CAGCCAGCAGGGGCGGCGGCTGG - Intergenic
1059278552 9:113114941-113114963 CAGCCAGCAGGGGCGGCGGCTGG + Intergenic
1060087346 9:120714473-120714495 CAGGCGGCCGGCCCCGCGGGCGG + Intergenic
1060793326 9:126499864-126499886 CAGCCCGCGGGCCGGGAGAGAGG + Intronic
1061028292 9:128064716-128064738 GAGCCACCGCGCCCGGCCGGGGG - Intronic
1061672757 9:132198285-132198307 CATGTCGCGGGCCCGGCGGGCGG - Exonic
1062034321 9:134376131-134376153 CAACCAGCGGGGCCGGTGGGAGG - Intronic
1062113870 9:134797115-134797137 GTGCCAGCGGGCCCGGCAGTGGG - Intronic
1062243210 9:135550622-135550644 CAGCCAGCGGCCCTGGGGAGAGG - Intergenic
1062433996 9:136538364-136538386 CAGCCAGCGGGACCCTGGGGCGG - Intronic
1062567012 9:137167968-137167990 CAGGCAGCGGGGTGGGCGGGCGG - Exonic
1185616750 X:1426566-1426588 GAGCCAGCGCGCCCGGCCTGAGG - Intronic
1185719856 X:2372894-2372916 CAGCCACCGCGCCTGGCTGGGGG + Intronic
1186425677 X:9463605-9463627 GAGCCACCGTGCCCGGCCGGAGG - Intronic
1186917980 X:14244211-14244233 GCGCGAGCGGGCCGGGCGGGTGG + Intergenic
1187528325 X:20073850-20073872 GAGCCACCGCGCCCGGCCGGTGG - Intronic
1188000048 X:24972253-24972275 GAGCCACCGGGCCTGGCCGGAGG + Intronic
1188477508 X:30603268-30603290 CAGGCGGCTGGCCGGGCGGGGGG - Intergenic
1191250431 X:58257583-58257605 AACCCAGCGGGCCCGGCGCAGGG - Intergenic
1195269394 X:103215345-103215367 CAGCCCCCGGGCCCCGCGGCGGG + Intronic
1199745775 X:150771264-150771286 CAGCCACCGGGGCAGGCAGGTGG - Intronic
1199851103 X:151725398-151725420 GAGCCAGAGGGCCAGGCAGGAGG - Intergenic