ID: 919728593

View in Genome Browser
Species Human (GRCh38)
Location 1:200899216-200899238
Sequence GACCTATGGTGGGGGAGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 171}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919728593 Original CRISPR GACCTATGGTGGGGGAGTGC AGG (reversed) Intronic
900002936 1:24932-24954 GCCCTGTGGTGGGGGCGTGCCGG - Intergenic
900022657 1:195457-195479 GCCCTGTGGTGGGGGCGTGCCGG - Intergenic
901640627 1:10691323-10691345 GAACTATGGTGGGGGAAAGGGGG + Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
903856029 1:26337960-26337982 GGCCTTTGGTGGCGGGGTGCAGG - Intronic
904620021 1:31769790-31769812 GACCTATAGCAGGGGAGTGTGGG - Intergenic
907941806 1:59095577-59095599 GAGCTATGGGAGGGGAGGGCAGG - Intergenic
909979466 1:82081482-82081504 GACCTGGGGTGGGAGGGTGCTGG + Intergenic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
912869318 1:113289476-113289498 GACCTATGGTTGGGGAGAAAGGG - Intergenic
913599951 1:120413584-120413606 CAGCTAAGGTGGGGGAGTGGGGG - Intergenic
914087107 1:144463079-144463101 CAGCTAAGGTGGGGGAGTGGGGG + Intergenic
914192889 1:145426166-145426188 CAACTAAGGTGGGGGAGTGGGGG + Intergenic
914311501 1:146471123-146471145 CAGCTAAGGTGGGGGAGTGGGGG - Intergenic
914590915 1:149104975-149104997 CAGCTAAGGTGGGGGAGTGGGGG + Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916070406 1:161166661-161166683 TACCTATTGTGGGTGAGTCCTGG + Exonic
916986893 1:170201454-170201476 GACTCATGGTGGGGAAGGGCAGG + Intergenic
918130260 1:181621333-181621355 GACTTGTGGTGGGGAAGTGAAGG + Intronic
918141838 1:181726402-181726424 GTCCTATGGTGGAGAAGTACAGG + Intronic
919728593 1:200899216-200899238 GACCTATGGTGGGGGAGTGCAGG - Intronic
923371892 1:233322771-233322793 GATCAAGGGTGGGGAAGTGCTGG - Intergenic
1062820571 10:531630-531652 GCCCTATGGTGTGGGTTTGCCGG - Intronic
1065523548 10:26594831-26594853 GACCTGTTGTGGGGGATTGAGGG - Intergenic
1065746218 10:28844993-28845015 GACCTATGATGGTGGAGTTTTGG + Intergenic
1073803894 10:107074199-107074221 GCCCGGTGTTGGGGGAGTGCAGG - Intronic
1077143374 11:1034561-1034583 GGCCTCTGGTGGGGGAGGGGTGG + Intronic
1078105645 11:8356529-8356551 GACCAGTGGTGGGGGCGTGGGGG + Intergenic
1078643954 11:13121179-13121201 GTCCTATGGTGGGGGAAGCCTGG - Intergenic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1082874859 11:57977859-57977881 GACCTGCTGTGGTGGAGTGCAGG + Intergenic
1083839509 11:65296059-65296081 GACCCATGAGGGGTGAGTGCCGG - Intronic
1083890820 11:65595078-65595100 GGCCTCGGGTGGGGGAGTGAGGG - Intronic
1084089305 11:66869815-66869837 GACCTCTGGTCGGGGGGTCCTGG - Intronic
1085284551 11:75351449-75351471 GACCTCGGGTGGAGGAGAGCTGG + Intronic
1088367395 11:109054006-109054028 GACCCTGGGTGGGGGAGTCCTGG + Intergenic
1089587517 11:119519847-119519869 GAGCTATGGTGGGGGAGGGCTGG + Intergenic
1091376355 12:26995-27017 GCCCTGTGGTGGGGGCGTGCCGG - Intergenic
1092000678 12:5029457-5029479 GGCCTGTTGTGGGGGAGTGGGGG + Intergenic
1092793326 12:12087993-12088015 GAACTGTGGTGGGGGAATGCCGG - Intronic
1094202787 12:27810344-27810366 GGGCTTTGGTGAGGGAGTGCAGG + Intergenic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096972807 12:55681391-55681413 GACTCATGGCGGGGGAGTGTCGG - Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097246293 12:57609485-57609507 GACCTAGGGTGGGGAAGGGAGGG + Exonic
1101640405 12:106582650-106582672 GCCCGATGGTGGGGAAGGGCCGG + Intronic
1106007832 13:25787748-25787770 GTCCCATGGTTGGGGAGTCCTGG + Intronic
1106654844 13:31732256-31732278 GACCCATGGAGAGGGTGTGCTGG - Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1110453712 13:75666492-75666514 GACCTATGGTGGTGTAGTGAGGG + Intronic
1112406491 13:99125224-99125246 GGCATATGGTGGGGGAGGTCAGG - Intergenic
1114835265 14:26196469-26196491 GAACTATGGTGGGGGGATGTGGG - Intergenic
1117741105 14:58820171-58820193 GTCCTCTGCTGGGGGAGTGAAGG - Intergenic
1118140273 14:63072756-63072778 AACCCATGCTGGGAGAGTGCTGG - Intronic
1119224932 14:72937785-72937807 GAAGGATGTTGGGGGAGTGCTGG + Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1120759360 14:88272033-88272055 GACCTATGGTAGGGGTAAGCTGG - Intronic
1121024625 14:90606263-90606285 GGCCTATGGTTGGGGTGTGCTGG + Intronic
1121250205 14:92493690-92493712 GACCTGTGGTGGGGGAAGGAGGG - Exonic
1122120644 14:99551824-99551846 GACCTAGGGAGGGGGCTTGCTGG - Intronic
1122429825 14:101633305-101633327 GAACTCCAGTGGGGGAGTGCGGG + Intergenic
1122501972 14:102206810-102206832 GAGCTGTGATGGGGGAGTGGAGG + Intronic
1122919737 14:104875075-104875097 GCCCTGTGGTGGGGCAGTGATGG + Intronic
1124125199 15:26932937-26932959 GGCCTGTGGTGGGGTAGTGCGGG + Intronic
1125248913 15:37676794-37676816 GCCCTATGGGGGGTGATTGCAGG + Intergenic
1125760111 15:42090566-42090588 GCCCTGTGGTGGGGTAATGCAGG + Intronic
1125760479 15:42092940-42092962 GCCCTGTGGTGGGGCAATGCAGG + Intronic
1129255281 15:74330784-74330806 GAGCTATGGTGGGGGAGCATCGG + Intronic
1131902759 15:97105890-97105912 GAACAATGGTGGGCGAATGCGGG - Intergenic
1132450573 15:101966007-101966029 GCCCTGTGGTGGGTGGGTGCAGG + Intergenic
1139827653 16:69770187-69770209 GACCTTTGGTTGGGGACTCCTGG + Intronic
1140488867 16:75317378-75317400 CTCCCATGGTGGGGGAGTCCTGG + Intronic
1141449079 16:84085071-84085093 CACCTATGGTGCTGGCGTGCGGG - Exonic
1141453992 16:84126273-84126295 GACCTATGATGGGGGTGCTCAGG + Intronic
1144744773 17:17606756-17606778 GACCTAGGATGGGGGAGGGCTGG - Intergenic
1145008104 17:19349106-19349128 TACCACTGCTGGGGGAGTGCTGG - Intronic
1145080753 17:19892458-19892480 GTTCTACGGTGGGGGAGTGGAGG + Intergenic
1145301701 17:21645518-21645540 GAGCTTTGGTGGGGGAGTAGAGG + Intergenic
1145328010 17:21848079-21848101 GAGCTTTGGTGGGGGAGTAGAGG + Intergenic
1145348608 17:22057806-22057828 GAGCTTTGGTGGGGGAGTAGAGG - Intergenic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145414977 17:22707549-22707571 GAGCTTTGGTGGGGGAGTAGAGG + Intergenic
1145694815 17:26779463-26779485 GAGCTTTGGTGGGGGAGTAGAGG + Intergenic
1145789266 17:27615110-27615132 GATCTAGGGTGAGGGACTGCTGG - Intronic
1146457638 17:33019902-33019924 AGCCTATGCTGGGGGAGGGCAGG + Intronic
1148063805 17:44854237-44854259 GGACTGGGGTGGGGGAGTGCTGG + Intronic
1152038954 17:77890963-77890985 GACCTCTGTTGGAGGTGTGCTGG - Intergenic
1152627381 17:81393843-81393865 GACCTGGGGTGGGGGGCTGCGGG - Intergenic
1154941822 18:21120904-21120926 AAGCCATGGTGGGAGAGTGCGGG - Intergenic
1159474977 18:68909943-68909965 ATCCTGTGGTGGGGGAATGCTGG + Intronic
1160634687 19:66540-66562 GCCCTGTGGTGGGGGCGTGCCGG - Intergenic
1160749445 19:727105-727127 GACCCAGGGTCAGGGAGTGCAGG + Intronic
1161089399 19:2352584-2352606 GACCTTTGGGGTGGGGGTGCTGG - Intronic
1161560078 19:4968434-4968456 GACCTACGGTGGCGGGGTGGAGG + Intergenic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1165425739 19:35744538-35744560 GACCTGGGGTGGGGGCGGGCAGG + Intronic
1166047803 19:40239868-40239890 GACATGTGGTGGGGGTGAGCAGG - Intronic
1166060488 19:40322516-40322538 GAGCCATGATGGGGGAGTCCAGG + Intronic
1166219975 19:41357903-41357925 GACCTTTGGTGGCGAAGTGCAGG + Exonic
1167588009 19:50385842-50385864 GACCTGTGGGGGGGAAGTGCAGG - Intronic
925140919 2:1549413-1549435 GACCAAGGGTGGGTGAGGGCAGG - Intergenic
925637278 2:5952289-5952311 GTCCTGTGGCAGGGGAGTGCTGG - Intergenic
933834043 2:86231699-86231721 GACTGATGGTGGGGGGGTGGGGG - Intronic
934863013 2:97780130-97780152 GACCTGTGTTGGGGAATTGCTGG + Intronic
936566790 2:113588487-113588509 GCCCTGTGGTGGGGGCGTGCCGG + Intergenic
937056991 2:118946320-118946342 GACTGCTGGTGGGGGAGTGAGGG - Intronic
937944550 2:127320415-127320437 GATCAATGGTGGGGGAGAGAGGG + Intronic
942593012 2:177566214-177566236 ACCCTATGGTGGAGGAATGCTGG - Intergenic
946333887 2:219025095-219025117 GACCTCTGGTCAGGGATTGCAGG - Intronic
946505684 2:220298346-220298368 GAACTGTGGGGAGGGAGTGCTGG + Intergenic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1170719196 20:18860318-18860340 GAGATTTGGTGGGGGAGTGGGGG + Intergenic
1171518279 20:25756901-25756923 GAGCTTTGGTGGGGGAGTAGAGG + Intergenic
1173856207 20:46252055-46252077 CACCTAGGGTGGGGGATTTCTGG - Intronic
1175110832 20:56646786-56646808 GCCCTGAGGTGGGGGTGTGCTGG + Intergenic
1176038529 20:63052112-63052134 GACCTGTGGTGGGGGCGGTCTGG - Intergenic
1176652440 21:9563315-9563337 GAGCTTTGGTGGGGGAGTAGAGG + Intergenic
1183196708 22:36358553-36358575 GAGAGATGGTGGGGGAGTTCAGG - Intronic
1183317811 22:37146489-37146511 GACCTTTGGAGGGTGAGTGTCGG - Intronic
1183498525 22:38164195-38164217 GACCTATGGTGCGGGGGCCCTGG - Intronic
1184302577 22:43570895-43570917 GCTCCATGGTGGGGGAGTCCAGG - Intronic
1184782659 22:46656944-46656966 GGCCTATGGTGGCTGAGGGCTGG - Intronic
1185138071 22:49084736-49084758 AAGCTGTGGTGGGGGAGTGCGGG - Intergenic
1185368596 22:50448147-50448169 GTCCTCTGGTGGGAGATTGCGGG - Intronic
950082541 3:10233938-10233960 AACCTATGGTGGGGGAGGTGGGG - Intronic
950412428 3:12847826-12847848 CACCTATGGTGGGGGTGGGTAGG + Intronic
950566101 3:13770554-13770576 GCCCTATGGTGGGAGGGGGCTGG - Intergenic
951526294 3:23656233-23656255 CCCCTTAGGTGGGGGAGTGCGGG + Intergenic
952179525 3:30902976-30902998 GAGCTAGGTTGGGGGATTGCTGG - Intergenic
953051667 3:39349819-39349841 GACCTATGATGGGGGGTGGCCGG - Intergenic
953108557 3:39909745-39909767 GACCTGTGGTGGGGCAGGGGAGG + Intronic
959402774 3:105923083-105923105 GACATAAGGTGGGGGTGTTCTGG - Intergenic
961715726 3:128856172-128856194 GACCTATGGTTGGGGGTGGCTGG + Intergenic
962631337 3:137279192-137279214 GACCTATGGAGGGGCAGTCGAGG + Intergenic
969131481 4:4993947-4993969 GACCAAGGGTGTGGGAGTCCAGG - Intergenic
971445494 4:26742075-26742097 GACATATGGAGGGAGAGTGAAGG + Intronic
973919882 4:55673977-55673999 TGCCTATGGTGGGGGAGGGGTGG + Intergenic
984691298 4:182729023-182729045 GCCCTATTGTCGGGGACTGCCGG + Exonic
992838043 5:80659409-80659431 TACCTAGGGCTGGGGAGTGCTGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1005436965 6:25822964-25822986 GATCAGTGGTGGGGGAGGGCAGG - Intronic
1006091574 6:31631793-31631815 GACCTATGGGGGACGAGGGCGGG + Exonic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1008013503 6:46491829-46491851 AAACTGTGGTGGGGGAGTACTGG + Intronic
1009804926 6:68590612-68590634 AACCTCTGCTAGGGGAGTGCAGG - Intergenic
1012291882 6:97466254-97466276 AACCTCTGGAGGAGGAGTGCTGG + Intergenic
1014632150 6:123801699-123801721 GAACTATGGTGGGGCACTGCTGG + Intergenic
1015568363 6:134596686-134596708 GGCCTGGGGTGGGGGGGTGCAGG - Intergenic
1025279106 7:57614242-57614264 GAGCTTTGGTGGGGGAGTAGAGG + Intergenic
1025305625 7:57851258-57851280 GAGCTTTGGTGGGGGAGTAGAGG - Intergenic
1028854706 7:95577458-95577480 GCCCTATGGAGGGGCAGAGCTGG - Intergenic
1029615020 7:101650827-101650849 GACAAAGGGTGGGGGAGGGCTGG - Intergenic
1031136427 7:117889218-117889240 AACGTGTGGTGGGGTAGTGCTGG - Intergenic
1033106294 7:138528335-138528357 TCCCCATGTTGGGGGAGTGCTGG + Intronic
1033599208 7:142876853-142876875 GATCTATGGTAGGAGAGTGCAGG + Intronic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1034487258 7:151373771-151373793 GACCTCTGCAGTGGGAGTGCTGG + Intronic
1038644774 8:29352226-29352248 GAGCTCCGGTCGGGGAGTGCAGG - Intergenic
1039611778 8:38924751-38924773 GACATACGGTGGGGGTGTGTTGG + Intronic
1039902333 8:41762017-41762039 GACCTGAGGTTGGGGAGGGCTGG - Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1042990062 8:74629434-74629456 TGCCTAGGGTGGGGGAGTGTTGG + Intronic
1045395659 8:101758299-101758321 AGCCTATGGAGGGGGAGAGCTGG - Intronic
1049187400 8:141264440-141264462 GACCTCTGCTGGGGGAGGGGAGG + Intronic
1049823022 8:144647632-144647654 GACCTTTGGTGGGTGAGGGAAGG + Intergenic
1053354420 9:37434026-37434048 GACCTAGGGTGGGGGTGGGAGGG - Intronic
1053477843 9:38394969-38394991 GACCTGTGGTTGGGGGATGCTGG + Intronic
1057474588 9:95387895-95387917 CACCAATGGTGGGGGTGTGTGGG + Intergenic
1058634026 9:107019190-107019212 GACCTCTGAAGGGGGAGTGTTGG - Intergenic
1061728789 9:132597280-132597302 GACCTGTGGTTGGGAAGTGGCGG + Intronic
1203630168 Un_KI270750v1:66856-66878 GAGCTTTGGTGGGGGAGTAGAGG + Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1186457988 X:9725732-9725754 GACCTATGAAGGGGATGTGCTGG - Exonic
1186643475 X:11482106-11482128 CAACTTTGGTGGGGGAATGCTGG + Intronic
1189178631 X:38982549-38982571 GACTTGTGGTGGAGGAGAGCTGG + Intergenic
1192410586 X:70929603-70929625 GAGATATGGTGGGGGAGGGAGGG - Intronic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1193673499 X:84418747-84418769 GACCCTTGGTGGGGGTGTGGGGG + Intronic
1194426004 X:93739209-93739231 GTGCTATGGTGGGGCAGTGGTGG + Intergenic
1195899566 X:109783247-109783269 CACCAATGGTGGGTGTGTGCGGG - Intergenic
1196173978 X:112619872-112619894 GACATATGGAGGGGGAATGTGGG - Intergenic
1197520916 X:127495237-127495259 GTCCTAGGGTGCGGTAGTGCTGG + Intergenic
1197916732 X:131543786-131543808 GACCTCTAGTGGAGGAGGGCTGG + Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1201077889 Y:10200454-10200476 GACCTGTGGTGGGGGTGGGGGGG - Intergenic