ID: 919729079

View in Genome Browser
Species Human (GRCh38)
Location 1:200901494-200901516
Sequence CTGTGGGCCTGGAGGGCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 748
Summary {0: 1, 1: 1, 2: 10, 3: 82, 4: 654}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919729079_919729092 1 Left 919729079 1:200901494-200901516 CCCGCTGCCCTCCAGGCCCACAG 0: 1
1: 1
2: 10
3: 82
4: 654
Right 919729092 1:200901518-200901540 GTGATGGCATCTCTGGGTCAGGG 0: 1
1: 0
2: 1
3: 26
4: 202
919729079_919729093 11 Left 919729079 1:200901494-200901516 CCCGCTGCCCTCCAGGCCCACAG 0: 1
1: 1
2: 10
3: 82
4: 654
Right 919729093 1:200901528-200901550 CTCTGGGTCAGGGTAGTGTGAGG 0: 1
1: 0
2: 4
3: 24
4: 235
919729079_919729091 0 Left 919729079 1:200901494-200901516 CCCGCTGCCCTCCAGGCCCACAG 0: 1
1: 1
2: 10
3: 82
4: 654
Right 919729091 1:200901517-200901539 GGTGATGGCATCTCTGGGTCAGG 0: 1
1: 0
2: 0
3: 22
4: 234
919729079_919729089 -6 Left 919729079 1:200901494-200901516 CCCGCTGCCCTCCAGGCCCACAG 0: 1
1: 1
2: 10
3: 82
4: 654
Right 919729089 1:200901511-200901533 CCACAGGGTGATGGCATCTCTGG 0: 1
1: 0
2: 4
3: 16
4: 195
919729079_919729090 -5 Left 919729079 1:200901494-200901516 CCCGCTGCCCTCCAGGCCCACAG 0: 1
1: 1
2: 10
3: 82
4: 654
Right 919729090 1:200901512-200901534 CACAGGGTGATGGCATCTCTGGG 0: 1
1: 0
2: 1
3: 13
4: 226
919729079_919729094 28 Left 919729079 1:200901494-200901516 CCCGCTGCCCTCCAGGCCCACAG 0: 1
1: 1
2: 10
3: 82
4: 654
Right 919729094 1:200901545-200901567 GTGAGGCTCCCGTGAGCCCAAGG 0: 1
1: 0
2: 2
3: 114
4: 1505

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919729079 Original CRISPR CTGTGGGCCTGGAGGGCAGC GGG (reversed) Intronic
900314997 1:2052004-2052026 CTTTTGGCCTGGAGGTCAGCAGG + Intronic
900389331 1:2427251-2427273 CCTGGGGCCAGGAGGGCAGCTGG + Intronic
900490991 1:2949080-2949102 GGCTGGCCCTGGAGGGCAGCTGG - Intergenic
900550619 1:3252609-3252631 GGGTGGGGCTGGTGGGCAGCAGG + Intronic
900571692 1:3361795-3361817 CTGCGGTCCAGGAGGGCAGGTGG + Intronic
900571699 1:3361828-3361850 CTGTGGCCCAGGAGGGCAGGTGG + Intronic
900571717 1:3361898-3361920 CTGCGGTCCAGGAGGGCAGGTGG + Intronic
900571734 1:3361964-3361986 CCGTGGCCCAGGAGGGCAGGTGG + Intronic
900571743 1:3361997-3362019 CCGTGGCCCAGGAGGGCAGGTGG + Intronic
900592935 1:3467895-3467917 CCGTGGGCGTGGCGGGCAGCGGG + Intronic
900662144 1:3790140-3790162 CCATGGGCCCGGAAGGCAGCCGG - Intronic
900670031 1:3846359-3846381 ATTTGGGGCAGGAGGGCAGCTGG + Intronic
900670373 1:3849637-3849659 ATTTGGGGCAGGAGGGCAGCTGG + Intronic
900736042 1:4300139-4300161 GTGTGGGCCAGGAGGCTAGCGGG + Intergenic
900762681 1:4483471-4483493 CCTTGGGCCTGGAGACCAGCAGG + Intergenic
900780374 1:4614030-4614052 CGGAGGGCCCTGAGGGCAGCTGG + Intergenic
901034807 1:6329996-6330018 CTGTGCGCATGGCCGGCAGCTGG + Intronic
901594934 1:10377403-10377425 CCGTGGGCCGTGATGGCAGCAGG + Exonic
902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG + Intronic
902370748 1:16005419-16005441 CTGTGTTCCTGGAAGGCAGATGG + Intronic
902410534 1:16209017-16209039 AGGTGGGGCTGGAGGGTAGCAGG + Exonic
902775360 1:18671124-18671146 CTGTGGGGCAGGAAGGCAGCAGG + Intronic
902923164 1:19679269-19679291 CAGCGGCCCTGGTGGGCAGCGGG - Exonic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903209882 1:21812006-21812028 CTGAGGGCCTAGAGAGCAGCAGG - Intergenic
903597069 1:24502992-24503014 CTGGGAGCCTGGTGGGCGGCGGG - Exonic
903661450 1:24981300-24981322 CTGAGGGTCTGGAAGGCATCAGG + Intergenic
903672919 1:25047020-25047042 GTGTGGGTCTGCAGAGCAGCTGG - Intergenic
903879733 1:26500638-26500660 CTGCGCACCTGGAGGGCATCTGG + Intergenic
904311586 1:29632789-29632811 CTGGGGGGCTGGAGGGCTGAGGG - Intergenic
904441676 1:30535821-30535843 CTGTGTGGTTGGAGGGCAGGGGG + Intergenic
905120587 1:35678830-35678852 GTGTGGGCCTGTAGGGGAGTGGG - Intergenic
905203037 1:36326651-36326673 CTGTGGGCAAGAAGGGGAGCAGG + Intronic
905254470 1:36671310-36671332 CTCTGGGCCAGTGGGGCAGCAGG - Intergenic
905824475 1:41018072-41018094 GTGTAGGCCAGGTGGGCAGCGGG + Exonic
906260121 1:44380621-44380643 CAGAGAGCCTGGAGGGCAGTGGG - Intergenic
906967421 1:50472103-50472125 CCGTAGGTCTGGAGGGGAGCTGG + Intronic
907188685 1:52631766-52631788 CTGGAGGCCTGGAGATCAGCTGG - Intergenic
907237840 1:53063528-53063550 CTGTGCGCCTGCAGATCAGCCGG - Intronic
907372636 1:54013324-54013346 CTGTGTTCCTGCAGGGCAGGGGG + Intronic
907463741 1:54621695-54621717 CTGGAGGGCTGGAGGGCAGAGGG + Intronic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
913330952 1:117667014-117667036 CTTTGGCCCTTGAGGGCAGTGGG + Intergenic
913332459 1:117678794-117678816 CTGTTGCCCTGGAGCCCAGCTGG + Intergenic
913531715 1:119738372-119738394 GTGTGGGGCTGCTGGGCAGCAGG - Intronic
914869608 1:151461865-151461887 CTGTTGGCTTGGACCGCAGCTGG + Intergenic
916599437 1:166277338-166277360 CTGTATGCCTGGGGGGCAGTTGG + Intergenic
917788852 1:178486901-178486923 CCTTGGGGCTGGAGGGCCGCTGG + Intergenic
919729079 1:200901494-200901516 CTGTGGGCCTGGAGGGCAGCGGG - Intronic
919768680 1:201143454-201143476 CTGGTGGACTGGACGGCAGCAGG - Intronic
919881361 1:201903335-201903357 CTTGGGGCCTGCAGGGCAGGAGG - Intronic
920096903 1:203492276-203492298 CTGTGGGGGTGGAGGGCCTCTGG + Intergenic
921063958 1:211609652-211609674 CAGGGGGCATGGAGGGCCGCAGG - Intergenic
921277780 1:213536642-213536664 CCTTGGGCCTGGATGGCAGAGGG + Intergenic
921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG + Intergenic
922455902 1:225773369-225773391 CTGTGGACCTGGTAGGCAGTGGG + Intergenic
922474783 1:225899342-225899364 CTGCCATCCTGGAGGGCAGCAGG - Intronic
922480693 1:225938594-225938616 CTTTGGGAGTGGAGGCCAGCGGG - Intronic
922618309 1:226976268-226976290 CTGCGGGGCTGCAGGGCTGCGGG + Intronic
923280570 1:232439278-232439300 CTGTGCACCTGGCAGGCAGCAGG - Exonic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
1063092507 10:2879713-2879735 CTGTGAGCCTGGAGGGTGGCAGG + Intergenic
1063515277 10:6688932-6688954 CTGTGGGAATCCAGGGCAGCGGG + Intergenic
1064297330 10:14090197-14090219 CTGAGGTCCTGGAGGGCTGCAGG + Intronic
1065088701 10:22207595-22207617 CTGCTGGCCTGGAGCTCAGCTGG + Intergenic
1065764548 10:29015645-29015667 CTGTAGGCCTGGGAGGCAGGGGG - Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067077733 10:43197678-43197700 CTGTGGGATTGGAGGTCAGGAGG - Intronic
1067297086 10:44980745-44980767 GGGTGGGGCTGGAGGGCAGTGGG + Intronic
1067433605 10:46262477-46262499 CTGAGGGCCTGGGGTGCAGTTGG - Intergenic
1067440079 10:46303828-46303850 CTGAGGGCCTGGGGTGCAGTTGG + Intronic
1067457154 10:46427218-46427240 GTGGGGCCCTGGAGGCCAGCAGG + Intergenic
1067513087 10:46911516-46911538 CTGGGGGCCAGGTGGGCAGGGGG + Intronic
1067535328 10:47105197-47105219 CTGTGGACCAGGAGTTCAGCTGG - Intergenic
1067630047 10:47957420-47957442 GTGGGGCCCTGGAGGCCAGCAGG - Intergenic
1067649166 10:48140326-48140348 CTGGGGGCCAGGTGGGCAGGGGG - Intergenic
1067741402 10:48898361-48898383 CCCTGGGCCTCCAGGGCAGCTGG + Intronic
1067792370 10:49298084-49298106 CTGTGGCCCTGGCTGTCAGCCGG + Intergenic
1067802447 10:49368408-49368430 CAGCGGGCCTGCAGGGCAGTGGG - Intronic
1068867654 10:61911736-61911758 CTTGGGGCTTGGGGGGCAGCGGG + Intronic
1070140171 10:73732895-73732917 CTGGGGGCGTGGGGGGCAGTGGG - Intergenic
1070320339 10:75350170-75350192 CTGGGAGCCTGGAGGGCTGGAGG + Intergenic
1070363950 10:75717583-75717605 CTGTGGGCCAGGAGGCAAGGAGG + Intronic
1070462389 10:76682881-76682903 CTGAGGACCTGGTGGGCCGCTGG - Intergenic
1071240697 10:83701558-83701580 GTGAGGACCTTGAGGGCAGCTGG - Intergenic
1071463621 10:85920753-85920775 CTGTGGGCGGGGAGGGAAGGGGG + Intronic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1071571574 10:86700195-86700217 CTGTGGGGCAGGAGAGCAGCAGG - Intronic
1072306116 10:94108755-94108777 CCATGGGACTGGAAGGCAGCAGG - Intronic
1072737911 10:97891583-97891605 CTGCCAGCCTGGAGGGCAGGGGG + Intronic
1073176401 10:101560074-101560096 CTGTGGGGCTGCAGGGAAGGGGG - Intergenic
1073426571 10:103458808-103458830 CAGTGGGCAGGGTGGGCAGCAGG - Exonic
1073512474 10:104051491-104051513 CTGTGGGCCAGGAGAGCCGCTGG + Exonic
1073867150 10:107818210-107818232 CTGGGGGCCAGGTGGGGAGCAGG + Intergenic
1074915423 10:117950713-117950735 CTGTGAGCCAGGAGAGCAGATGG + Intergenic
1075599136 10:123754412-123754434 CACTGTGCCTGGAGGCCAGCTGG + Intronic
1075650011 10:124121595-124121617 CTCTGGGCCTGGAGAGCTCCTGG - Intergenic
1075657980 10:124174428-124174450 CTTTGGGGCTGGAGGGCACTGGG - Intergenic
1076088476 10:127657547-127657569 CTGTGGGGCTGGAGTCCTGCAGG - Intergenic
1076159786 10:128234897-128234919 CCCTGGGCCTGGAGGCCAGATGG + Intergenic
1076216306 10:128696271-128696293 CTGAGGGCATGGAGGGCTGTGGG - Intergenic
1076317199 10:129550952-129550974 GTTTCGGCCTGGAGGGCAGGTGG + Intronic
1076371525 10:129959078-129959100 CTGCAGGCCTGGCTGGCAGCAGG + Intronic
1076399922 10:130175837-130175859 CAGTGGGCCTGGGGTGCAGTGGG - Intronic
1076402692 10:130194205-130194227 CCAGGGGCCTGCAGGGCAGCAGG - Intergenic
1076569872 10:131425669-131425691 CTGTGGGCCCTGAGGTCAGTTGG - Intergenic
1076726612 10:132416893-132416915 CTGTGGGCCCTGAGGGAAGGAGG + Intronic
1076830528 10:132992199-132992221 CTGTGAGCCTCGAGGACAGAGGG + Intergenic
1077094513 11:793620-793642 CTGTGGGGCAGGGGGTCAGCTGG + Intronic
1077138612 11:1013730-1013752 CTGTGAGCCGGGAGCTCAGCGGG - Intronic
1077141436 11:1026601-1026623 CTGTGGCCTTTGTGGGCAGCTGG + Intronic
1077187933 11:1243765-1243787 ATGTGGGGCTGCTGGGCAGCAGG - Exonic
1077188360 11:1245436-1245458 ATGTGGGGCTGCTGGGCAGCAGG - Exonic
1077188890 11:1247536-1247558 ATGTGGGGCTGCTGGGCAGCAGG - Exonic
1077189315 11:1249207-1249229 ATGTGGGGCTGCTGGGCAGCAGG - Exonic
1077326680 11:1967013-1967035 CTGGGGGGCTGCAGGGCCGCCGG + Intronic
1077364988 11:2158061-2158083 GTGTTGGAGTGGAGGGCAGCAGG - Intronic
1077365182 11:2158722-2158744 CTGTGGCCTGGGAGGTCAGCGGG - Intronic
1078186453 11:9055732-9055754 GGCTGGGCCTGGAGGGGAGCAGG - Intronic
1080711069 11:34748551-34748573 CTAGTGGCCTGGAGGGCAGGAGG + Intergenic
1081154307 11:39670137-39670159 CTGAGAGCCTGGAGAGGAGCTGG - Intergenic
1081703523 11:45166536-45166558 CAGGGGGCCTGGATGCCAGCAGG + Intronic
1082102407 11:48183560-48183582 GTGTGGGCCCAGAGGGCAGAGGG + Intergenic
1082813573 11:57493716-57493738 CTCTGGGCCTGTCGGGTAGCTGG - Intronic
1082821176 11:57545791-57545813 CTGTGGGGCTGGAGGGTGGGTGG - Intronic
1083799555 11:65038651-65038673 CTGGGAGCCAGGAGGGCAGGAGG + Exonic
1083827764 11:65212796-65212818 GTGAGGGGCTGGAGGGCAGGAGG + Intergenic
1083859461 11:65412146-65412168 GTGTGGGTCTGGAGGCCAGGTGG - Exonic
1084264833 11:67999498-67999520 AGGTGAGCCTGGTGGGCAGCAGG - Exonic
1084268186 11:68015499-68015521 AGGGGGGCATGGAGGGCAGCTGG + Intronic
1084269194 11:68020057-68020079 CTAAGAGCCTGGGGGGCAGCAGG - Intronic
1084359819 11:68661923-68661945 CTGTTGGCTGGGAGGGGAGCTGG + Intergenic
1084419902 11:69055118-69055140 CTCTGGGCCCTGAGGGCTGCTGG + Intronic
1084740344 11:71135336-71135358 CTAAGCGCCTGGGGGGCAGCTGG - Intronic
1084758466 11:71253116-71253138 TTCTTGGCTTGGAGGGCAGCTGG - Intergenic
1085021491 11:73213008-73213030 CTGTGGGCATGGAGGAAAGCTGG + Intergenic
1085027480 11:73244992-73245014 GAGTGGGCCTGGAGGGGAGGAGG + Intergenic
1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG + Intergenic
1085345782 11:75767518-75767540 CTGTAGGTCAGGAGGGCAGTGGG - Intronic
1089014446 11:115154933-115154955 CTGTGGGCCTGGCTCGCATCCGG + Intergenic
1089046090 11:115503501-115503523 CTGTGGGGCGGGCGGGCTGCGGG + Intronic
1089253415 11:117180989-117181011 CTGTGAGCCAGGAAGCCAGCAGG - Intronic
1089255705 11:117192805-117192827 ATGCGGTCCTGGAGGGAAGCAGG - Exonic
1089383440 11:118052368-118052390 CTGGGGCCCTGCAGGGAAGCAGG + Intergenic
1089462425 11:118660999-118661021 CTGTGGGGCCCAAGGGCAGCTGG - Intronic
1091042618 11:132296201-132296223 TTATGGGCCTGGAGCTCAGCAGG + Intronic
1202809661 11_KI270721v1_random:22193-22215 CTGGGGGGCTGCAGGGCCGCCGG + Intergenic
1091403703 12:196262-196284 CTGTGGGCCAGGAGGGGAACTGG + Intronic
1091545264 12:1497484-1497506 CTCTGGGGCTGGGGGGAAGCTGG + Intergenic
1091714923 12:2770231-2770253 CTGCAGGCATGGAGGGCAGTGGG - Intergenic
1092088585 12:5785833-5785855 CTGCTGGCCTGGAGGGTAGATGG - Intronic
1092230511 12:6773253-6773275 TTGTGGGGCTGCAGGGGAGCTGG - Exonic
1092259746 12:6946470-6946492 CTTTGGGGCTGCAGGGAAGCTGG + Intronic
1092264382 12:6969970-6969992 CTGTGGTCGTGGAGAGGAGCAGG - Intronic
1096001971 12:48137707-48137729 CTGGGCTCCTGCAGGGCAGCAGG + Exonic
1096467647 12:51856182-51856204 CTGTAGGCATGGAGGCTAGCTGG - Intergenic
1096513557 12:52144748-52144770 GCCTGGGCCTGGATGGCAGCTGG + Intergenic
1096740068 12:53686714-53686736 CTGTTGGCCTGTAGTGCAGATGG - Intergenic
1097730563 12:63123653-63123675 CTGGGTGCCTGGATGGGAGCAGG - Intergenic
1097755301 12:63401074-63401096 CTGTCTGCCTGCAAGGCAGCCGG - Intergenic
1097967616 12:65597567-65597589 TTGGGTACCTGGAGGGCAGCAGG + Intergenic
1099729633 12:86484300-86484322 CTCTTGGCCTGGTGGCCAGCTGG - Intronic
1099973599 12:89524933-89524955 CTGGGGGCCGGGATGGCAGAGGG + Intronic
1100532667 12:95474509-95474531 CTGTGGGACTAGAGGGCTGGTGG + Intronic
1101376001 12:104172209-104172231 CAGTGCTCCTGGAGGGGAGCAGG + Intergenic
1101957353 12:109222989-109223011 CTGAGCACCTGGAGGGCAGGAGG - Intronic
1102541445 12:113622332-113622354 CTGGAGGCCTGCAGGGAAGCTGG + Intergenic
1102961422 12:117095961-117095983 CTGTGGGACTGCAGGCAAGCTGG + Intronic
1103328490 12:120137569-120137591 CTGTGGTTCTGGAGGAGAGCTGG - Exonic
1103924186 12:124414620-124414642 ATGTTTACCTGGAGGGCAGCAGG - Intronic
1104185195 12:126423798-126423820 CTCTGGCCCTGGAGAGCAGTGGG + Intergenic
1104761408 12:131299362-131299384 CTATTTCCCTGGAGGGCAGCTGG - Intergenic
1104806119 12:131590543-131590565 CTGTAGGTCTGGAGGGGGGCTGG + Intergenic
1104818368 12:131661430-131661452 CTGTTTCCCTGGAGGGCAGCTGG + Intergenic
1104830831 12:131750111-131750133 CTGTGGCCCTGGTGGGAGGCAGG - Intronic
1104836915 12:131797642-131797664 CAGTGTGCCTGGTGGGCATCAGG - Intronic
1104928257 12:132324906-132324928 CTGTGGGGCTGGAGGGCTTGGGG - Intronic
1106578578 13:30998870-30998892 CTGTGGGCAGGGAGGAGAGCAGG + Intergenic
1107446718 13:40475888-40475910 CAGTGAGCTGGGAGGGCAGCAGG - Intergenic
1109077690 13:57858606-57858628 CTGTGGGATTGGAGGGCAAGAGG + Intergenic
1109242936 13:59913386-59913408 CTGTGGGCTGTGAGGGAAGCTGG - Intronic
1109452849 13:62540821-62540843 CTGGTGGCCAGGAGGGCAGGTGG - Intergenic
1112693840 13:101925924-101925946 CTGTGAGCCAGGAAGGCAGGTGG - Intronic
1113682649 13:112255095-112255117 CTGTGGGACTGGTGGGGAGATGG + Intergenic
1113830547 13:113292215-113292237 CCGTGGGCGTGGGCGGCAGCGGG - Intergenic
1113956202 13:114101037-114101059 CTGGGGGCCTGAGGAGCAGCCGG + Intronic
1114083489 14:19220435-19220457 CTGTGGGCTGGGGGAGCAGCTGG + Intergenic
1114245205 14:20906362-20906384 CTGTCTGCCTTGAGGGCACCAGG + Intergenic
1114551235 14:23534019-23534041 CTGAGGCCCTGGAAGGCTGCAGG + Exonic
1115694404 14:35881232-35881254 CTGTATGCCTGGGGGGCAGTTGG - Intronic
1116149982 14:41128702-41128724 CTGGGGGGCTGGAGGGCTGGGGG - Intergenic
1116292274 14:43059371-43059393 CAGAGGGGTTGGAGGGCAGCAGG + Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1118982417 14:70727536-70727558 CTGTGGTCCTGGTCGGGAGCAGG - Intronic
1119182605 14:72614815-72614837 CTAAGGAGCTGGAGGGCAGCAGG - Intergenic
1119399005 14:74349273-74349295 CGGTGGCCCTGGAGGCCAGCTGG - Intronic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1120786448 14:88541922-88541944 CTGTGGGCCTGGAGGCTTCCTGG - Intronic
1120831767 14:89003797-89003819 CTGTGGCCTTGGAGATCAGCAGG - Intergenic
1121320115 14:92987265-92987287 CTGTGGGCCTGATGTGGAGCTGG + Intronic
1121323072 14:93004043-93004065 CTCTGGGCCTGGGAGGCATCTGG - Intronic
1121407170 14:93726109-93726131 CCCTGGGCTTGGAGGGCAGCAGG + Intronic
1121432150 14:93895176-93895198 AGGTGGGCCTGGGTGGCAGCAGG - Intergenic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1122542434 14:102505789-102505811 CTGGGGGCAGGGTGGGCAGCAGG + Exonic
1122609208 14:102969707-102969729 TGGTGGGGCTGGAGGGTAGCAGG - Intronic
1122692440 14:103537685-103537707 CTGGGTGGGTGGAGGGCAGCAGG + Intergenic
1122779959 14:104139349-104139371 CTTGGGGCTTGGAGGGAAGCAGG + Intronic
1122922653 14:104886374-104886396 CTGCGGGCCCAGAGAGCAGCAGG + Exonic
1202895094 14_GL000194v1_random:2204-2226 CTGTGGGCTGGGAGGCCAGCTGG + Intergenic
1123907271 15:24933314-24933336 CTGTGGCTCTGGAGGGCGGCTGG + Intronic
1124657916 15:31523730-31523752 CTCTGGGGCTTGAGGGCTGCAGG - Intronic
1125429868 15:39582907-39582929 CTCTGGGGCTGGGGTGCAGCAGG - Intronic
1127832769 15:62765392-62765414 CTGTGGGCCGGGAGGGATGCGGG - Intronic
1127905190 15:63371220-63371242 GTGTGGGCCTGGAGGACTTCAGG + Intronic
1127974231 15:63985390-63985412 CTCTGGGCCTCGAGGACAGCGGG + Intronic
1128111061 15:65076632-65076654 CTGCAGGCCCGGAGGGCATCTGG - Intronic
1128730234 15:70015811-70015833 CTGGGGGTCAGGAGGGCTGCGGG - Intergenic
1128882062 15:71252995-71253017 CTGCAAGCCTGGAGGGCAGAGGG - Intronic
1128927186 15:71668438-71668460 CTCTGAGCCTGGAAGACAGCAGG + Intronic
1129654472 15:77514882-77514904 CTGTGGGGATGCAGAGCAGCAGG + Intergenic
1129937509 15:79463163-79463185 ATGTGGGCCTTGAGGGAGGCAGG - Exonic
1130956435 15:88630343-88630365 GTGGGGGCCAGGAGAGCAGCGGG + Exonic
1131452887 15:92560888-92560910 CTGTGGACCTGGAGGCAGGCAGG + Intergenic
1131955603 15:97732055-97732077 ATGTGGGCCTGGGAGGCAGCAGG + Intergenic
1132156133 15:99496361-99496383 GTGTGGGCAGGGAGGGCAGAAGG + Intergenic
1132207083 15:99993622-99993644 ATGTGCACCTGGAGGCCAGCTGG - Intronic
1132558912 16:584663-584685 TGGTGGGCCAGGTGGGCAGCTGG - Intergenic
1132574108 16:656880-656902 CCGTGGGGCTGGTGGCCAGCTGG - Intronic
1132595253 16:746208-746230 CTGCGGGTCTGCAGGGCTGCAGG + Intronic
1132595298 16:746383-746405 CTGCGGGTCTGCAGGGCTGCAGG + Intronic
1132746830 16:1439678-1439700 CTGGGGGGCAGGAGGCCAGCAGG - Intronic
1132943095 16:2518181-2518203 TGGTGGCCCTGGAGGGCAGCTGG + Intronic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133130425 16:3673299-3673321 CTGTGTGCTCAGAGGGCAGCAGG + Intronic
1133232176 16:4372002-4372024 CTGTGGGGCTGGGGGGCTGCGGG + Intronic
1133966784 16:10537514-10537536 CAGTGGGGCTGGAGTGCAGTGGG - Intronic
1134042475 16:11079059-11079081 GTGTGGGGCTGCAGGGCTGCAGG - Intronic
1134260582 16:12647967-12647989 CTGAGGGCCAGGAGGGCTGGAGG - Intergenic
1136417476 16:30112794-30112816 CTGTGGGGGTGAAGGTCAGCGGG + Intronic
1136612904 16:31378057-31378079 CTGGAGACCTGGTGGGCAGCTGG - Intronic
1136922994 16:34346704-34346726 TTCTGGGCCTAGAGGCCAGCTGG + Intergenic
1136981579 16:35065102-35065124 TTCTGGGCCTAGAGGCCAGCTGG - Intergenic
1137501263 16:49013351-49013373 CTGTGAGGCTGCAGCGCAGCCGG + Intergenic
1137571408 16:49568606-49568628 CTGTGGGGCAGGAGAGCAGGCGG - Intronic
1137679699 16:50329670-50329692 CTGTGGTCAGGAAGGGCAGCCGG + Intronic
1139357769 16:66377456-66377478 CAGTGGGCCCAGAGGTCAGCTGG + Intronic
1141233956 16:82198021-82198043 CTGTCGGCAGGGAGGTCAGCGGG + Intergenic
1141749151 16:85946716-85946738 CTGGAGACCTGGAGGCCAGCTGG - Intergenic
1141749217 16:85946995-85947017 CTGGGGTCTTGGAGGGGAGCAGG - Intergenic
1141956594 16:87376079-87376101 CTGTGGCAGTGGAGGGCAGGGGG - Intronic
1142059064 16:88018172-88018194 CTGTGGGGCTGCAGGGCCTCGGG - Intronic
1142249932 16:88986564-88986586 CTGTGGGGCTGTAGGGGGGCAGG - Intergenic
1142264782 16:89058649-89058671 CTGTGGGCCAGGAGGGACCCAGG - Intergenic
1142292979 16:89201218-89201240 CTGGGGGCGGGGAGGGCTGCGGG + Intronic
1142361506 16:89629777-89629799 CTGTGACGCTGGAGGGCTGCAGG + Intronic
1142502335 17:340060-340082 CAGTGGGTCTGGTGGGGAGCAGG - Intronic
1142589724 17:997411-997433 CTGAGGGCCTGGACGGCAGTGGG + Intronic
1142719469 17:1766744-1766766 CTGGGGGCCTGGAGGGGTGAGGG + Intronic
1142878712 17:2868129-2868151 CTGCTGGGGTGGAGGGCAGCTGG - Intronic
1143106101 17:4531330-4531352 CTGGGGGCCCCGAGGGCGGCGGG - Intronic
1143272110 17:5683474-5683496 CTGGGGCCGTGGAGGGCAGGGGG + Intergenic
1143558316 17:7676325-7676347 CTGGGGACCTGGAGGGCTGGGGG - Intronic
1143610421 17:8014783-8014805 GGGTGGGCTGGGAGGGCAGCTGG + Intronic
1143773555 17:9183244-9183266 GTGTTGGGCTGGCGGGCAGCTGG - Intronic
1144092667 17:11871962-11871984 CAGGTGGCCTGGAGGGCAGTGGG - Intronic
1144466702 17:15502934-15502956 CTTTGGGCCTGGAGGGGAGGTGG - Exonic
1144653430 17:17020947-17020969 CTGTGGCCCTGCAGGGCACCCGG - Intergenic
1144674691 17:17154237-17154259 CTTTGGAGATGGAGGGCAGCAGG + Intronic
1144685440 17:17223059-17223081 CTGTGCTTCTGGAGGGCAGAAGG + Intronic
1144753827 17:17667829-17667851 CACAGGCCCTGGAGGGCAGCAGG + Intergenic
1144833298 17:18143624-18143646 GTGTGGGTCTGGGTGGCAGCAGG + Intronic
1144952322 17:19000888-19000910 CTGTGAGCCTGGGAAGCAGCTGG + Intronic
1145761973 17:27430322-27430344 GTCTGGGGCTGCAGGGCAGCTGG - Intergenic
1146063601 17:29619423-29619445 CTTGGTGCCTGGAGAGCAGCAGG - Intronic
1146208959 17:30927017-30927039 CTATGGGCCTGGTGCGCAGGTGG + Intronic
1146615711 17:34355789-34355811 CTCTGGGCCTGAGGGGCAGAAGG + Intergenic
1147304978 17:39556873-39556895 CTGAGAGCCAGGAGGGCAGCAGG - Intronic
1147359409 17:39921725-39921747 ATGTGGGCAGGGAGGGAAGCAGG - Intronic
1147447612 17:40484313-40484335 CCTTGGGGCTGGAGGGCATCGGG + Intronic
1147536375 17:41325310-41325332 CTGTGGGCACCAAGGGCAGCTGG - Intergenic
1148000838 17:44386042-44386064 CTGTGCCCCTGGAGGGCCGAGGG - Exonic
1148241821 17:46004202-46004224 CTGTGGGGCTGTGGGGCTGCAGG + Intronic
1148804399 17:50257111-50257133 CTCTGAGCCTGGGGGACAGCAGG + Intergenic
1148806897 17:50268503-50268525 CTGTGGGCCGGGAGGGTGGAGGG - Intergenic
1150076131 17:62193632-62193654 TAGTGGGCTTGGAGGACAGCAGG - Intergenic
1150206496 17:63412516-63412538 CTGTGGGCTTGGGGAGCAGCTGG - Intronic
1150212194 17:63447286-63447308 CTCGGTGCCTGGAGGGCAGGTGG - Intergenic
1150359536 17:64519244-64519266 CTGAGGACCTGGAGAGCTGCTGG - Intronic
1150618225 17:66788871-66788893 CTGTGGGCCTGAGGGGGAGAGGG + Exonic
1150790186 17:68196711-68196733 CCATTGGGCTGGAGGGCAGCAGG + Intergenic
1151305378 17:73259778-73259800 CTGGGGGGCTGGAGGGGACCAGG - Intronic
1151375546 17:73686367-73686389 CTGGGGGCCTGTGGGGCAGTGGG - Intergenic
1151425715 17:74029851-74029873 CTGTGGGGGTGGAAAGCAGCTGG + Intergenic
1151578055 17:74962808-74962830 ATGTAGGCCTGGGTGGCAGCTGG - Intronic
1152066151 17:78113497-78113519 CTCTGAGCCTGGAGGGGAGAGGG - Intronic
1152141287 17:78538307-78538329 CTGTGAGGCTGCAGGGCTGCAGG + Intronic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152290535 17:79437490-79437512 CTGAGGTCCTGGAGGGCTGCTGG + Intronic
1152568634 17:81111558-81111580 CTGCAGACCTGGAGGGCTGCTGG + Intronic
1152739099 17:82011301-82011323 GGGTGGGGCTGGGGGGCAGCGGG + Intronic
1152848061 17:82614455-82614477 CTGTGGGCCTGAAGAGGCGCCGG - Intronic
1152851624 17:82639874-82639896 GTGTGGGTCGGGAGGGCTGCTGG + Intronic
1153660061 18:7318098-7318120 CTGTGGGCCTGGGAGACAGAAGG - Intergenic
1153946267 18:10020569-10020591 CTGTTGGTCTGGATTGCAGCTGG + Intergenic
1153985146 18:10344571-10344593 GTGTGGGACAGGAGGGCATCAGG - Intergenic
1154106538 18:11528259-11528281 CTGTTGGCCAGGATGGCATCTGG - Intergenic
1154172963 18:12063913-12063935 CTGGGGGCCTGGAGCAGAGCAGG + Intergenic
1154174568 18:12076824-12076846 CTCTGGGCCTGGAGGGAGCCAGG + Intergenic
1154500170 18:14992097-14992119 CTGTGGGCTGGGAGGGCAGCTGG + Intergenic
1156476846 18:37410865-37410887 CAGTGCCCCTGCAGGGCAGCTGG - Intronic
1156804919 18:41166564-41166586 CAGAGGGCCTGGAATGCAGCAGG - Intergenic
1157446266 18:47748833-47748855 CTGTGATCCTGGAGGCCAGAGGG - Intergenic
1158499178 18:57984486-57984508 CTGTGGGACAAGAGAGCAGCTGG - Intergenic
1158551810 18:58442560-58442582 CAGTGGGGCTGGAAGGAAGCTGG - Intergenic
1158706356 18:59795842-59795864 CTGTGGGCCTGGAGGGTAACTGG + Intergenic
1158908559 18:62037567-62037589 CTGTGAGCACTGAGGGCAGCGGG + Intergenic
1158920686 18:62187741-62187763 CAGTGGCCCTGGGGGGCACCGGG + Exonic
1160009127 18:75090234-75090256 CTGTTGGCCTGGAAGGCTGGAGG + Intergenic
1160431591 18:78816790-78816812 CTGTCAGCCTGGTGGGCAGAAGG - Intergenic
1160545453 18:79650150-79650172 CTGTGGCCCGTGAGAGCAGCTGG - Intergenic
1160681314 19:412835-412857 CGGCAGGCCTGGAGGTCAGCCGG - Intergenic
1160707160 19:535060-535082 CTGTGGCCCAGGAGGGCCGTGGG + Intronic
1160725121 19:614448-614470 CTGTGTGCCAGCAGGGCAGGTGG + Intronic
1160774029 19:846597-846619 CTGTGGTCCTAGAGGGGAGTGGG - Intronic
1161004795 19:1929860-1929882 CGGGGGACCTGGCGGGCAGCTGG + Intergenic
1161041618 19:2113497-2113519 CTGGGGGCAGCGAGGGCAGCTGG - Intronic
1161067202 19:2244479-2244501 CTGAGGGCCTTGACGGCAGCAGG + Intronic
1161256997 19:3315111-3315133 CTGTGGCCCACGAGGGCACCAGG + Intergenic
1161731558 19:5964049-5964071 CCGTGGGCCCGGATGCCAGCAGG - Intronic
1161900663 19:7116839-7116861 CTGTGAACCTGGAGGGCAAGGGG - Exonic
1161956723 19:7500214-7500236 CTCTAGGCCTGGAGGCCAGCAGG - Intronic
1162017389 19:7852995-7853017 CTGTTGCCCTGGAGGGGGGCAGG - Intronic
1162736068 19:12747769-12747791 CTGTGACCCTGGAGAGCAGGGGG + Intronic
1162754161 19:12847319-12847341 CCGTGGGCTGGTAGGGCAGCTGG - Exonic
1163061857 19:14766935-14766957 CTGTGAGGCTGGACGGGAGCTGG - Intronic
1163102747 19:15107808-15107830 CTGAGGGCCTGGAGGGTGGAGGG + Intronic
1163360087 19:16840435-16840457 CTGGAGGCCTGGAGGCCAGGAGG - Intronic
1163360272 19:16841603-16841625 CTGAGAGCCTGGAGGCAAGCAGG - Intronic
1163427103 19:17245762-17245784 CTCCGGGCCTGCAGGGCCGCTGG + Exonic
1163622646 19:18369971-18369993 TTGTGGGGCTGGAGTTCAGCTGG + Intergenic
1163737750 19:18991814-18991836 GTGGGGGCCTGGAGTGGAGCTGG - Intronic
1164518764 19:28960616-28960638 CTGTGGGTCTTCAAGGCAGCAGG + Intergenic
1164823760 19:31269024-31269046 GTGTGGACCTGCTGGGCAGCAGG - Intergenic
1165060105 19:33201042-33201064 CTGAGGACCTGCTGGGCAGCTGG - Intronic
1165152198 19:33767327-33767349 CTGTGAGCCTAGAGAGGAGCGGG + Intronic
1165767087 19:38358363-38358385 CTGTGGGCCAGGAGGGGCCCAGG + Intronic
1165890103 19:39106845-39106867 CTGTCTTCCTTGAGGGCAGCAGG + Intronic
1166198335 19:41220621-41220643 CTGCGTGCCTGGAGGGGAGATGG - Exonic
1166416040 19:42595566-42595588 CTGTGGGCCTAGTGGTCATCAGG + Intronic
1166428175 19:42698148-42698170 ATGTGGAGCCGGAGGGCAGCCGG - Intronic
1166903094 19:46081728-46081750 CTGAGGGCATTCAGGGCAGCTGG - Intergenic
1167411637 19:49347544-49347566 CTGTAGGACTGCAGGGCTGCAGG - Intronic
1167509485 19:49888537-49888559 CTGTGTCCGTGGAGGGCGGCGGG - Exonic
1168103852 19:54155173-54155195 GTGTGTGCGTGCAGGGCAGCTGG + Exonic
1168564553 19:57412221-57412243 GAGTGGGCCTGGGGGGCTGCTGG - Intronic
925060359 2:885758-885780 CTGGGGGCTTGGAGGGGAACTGG + Intergenic
925189550 2:1871658-1871680 CTGAGAGCCTGGGGAGCAGCTGG - Intronic
925357185 2:3250120-3250142 TCTTGGGCCTGGAGGGCAGAAGG - Intronic
925358243 2:3258009-3258031 CTGGAGCCCTGGTGGGCAGCAGG + Intronic
926325374 2:11780626-11780648 ATGAGGGCCTGGGAGGCAGCAGG + Intronic
926588643 2:14716632-14716654 CCATGGTCCTGGAGGGCAGCAGG + Intergenic
927667302 2:25041818-25041840 CTGGGGTCCTCGAGGTCAGCCGG - Intergenic
927848733 2:26485730-26485752 CTGTGGCCCTGGTGGGCTCCCGG + Intronic
929668619 2:43852487-43852509 GTGAGGGCCTGGGGGGCAGATGG + Intronic
929789694 2:45013764-45013786 GTGAAGGCCTGGAGGGCAGAGGG - Intergenic
929930551 2:46252408-46252430 ATTTGGGCCTGGGGGGAAGCAGG + Intergenic
929956123 2:46460060-46460082 CTGTGGGCCTGGAAGGTGGAAGG - Intronic
930100821 2:47601491-47601513 CTCTAGGCCTTGGGGGCAGCAGG - Intergenic
932005450 2:67922604-67922626 CTGTTGGCCTTGAGGGGAGAAGG + Intergenic
932641067 2:73447492-73447514 CTGTGGGACTTGGGGGCAGGAGG + Intronic
932795504 2:74692018-74692040 CACTGGGCCAGGAGGGAAGCTGG + Intergenic
933356676 2:81218994-81219016 GTGTGGGGCTGGAGGGGAGGTGG - Intergenic
933362264 2:81303160-81303182 CAGTGGGCCTGGAGGAAAGCAGG - Intergenic
933854482 2:86400027-86400049 CTGAGGGTGTGGGGGGCAGCAGG + Intergenic
934494847 2:94788086-94788108 ATCTGGGGCTGCAGGGCAGCTGG + Intergenic
934778091 2:96951466-96951488 CTGTTGGGCTGGCGGGGAGCTGG + Exonic
934861564 2:97767822-97767844 CTGTGGGCTGGGAGGACAGAAGG - Intronic
934951125 2:98576422-98576444 CTGTGGGGCTGGTGGTCAGGAGG + Intronic
934954455 2:98605934-98605956 CAGTGGGGCTGGAGGAAAGCAGG - Intronic
935664277 2:105496683-105496705 CTTTGAGCCAGGTGGGCAGCTGG + Intergenic
936370162 2:111897123-111897145 CTGTATGCTTGGAGGGAAGCGGG - Intergenic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
937166937 2:119828173-119828195 CTGTTGGCTGGGAGGTCAGCTGG - Intronic
937222930 2:120352539-120352561 CTGAGGCCCTGCAGGGCTGCTGG + Intergenic
937339164 2:121079968-121079990 CTGAGGGTCTGGAGGGTAGGAGG + Intergenic
937862213 2:126720085-126720107 CTGTGGGCCTTGAGGGAAGTGGG + Intergenic
937977927 2:127593036-127593058 CTGGGGCCGGGGAGGGCAGCGGG - Intronic
938236157 2:129708712-129708734 CTGGGAGCCTGGAGGGGACCAGG + Intergenic
938293413 2:130162243-130162265 CCGTGGTGCTGCAGGGCAGCAGG - Intronic
938310477 2:130285748-130285770 CTGGGGGCCTGGAGCAGAGCAGG - Intergenic
938368861 2:130756357-130756379 CTGGGGGCCCGCAGTGCAGCAGG - Exonic
938444452 2:131366619-131366641 CTGGGGGCCTGGAGCAGAGCAGG + Intergenic
938493096 2:131776197-131776219 CTGTGGGCTGGGACGGCAGCTGG - Intergenic
938499383 2:131822456-131822478 CTGTGGGCTGGGAGGGCAGCTGG + Intergenic
941229821 2:162897921-162897943 CTGTGGGCCTGGATGGGGGCTGG - Intergenic
941619549 2:167760963-167760985 ATGTGAGCCTGGAGTGCAGCAGG + Intergenic
941656910 2:168154060-168154082 CTGTGGACCAGGATGACAGCAGG + Intronic
942251087 2:174048442-174048464 CTGCGGGCCTGGCGGGGAGCCGG - Intergenic
942346312 2:175005729-175005751 CAGTGAGCCTGGAGGGCGCCAGG - Intergenic
942481775 2:176395666-176395688 CTGTGAGCCTCCAGGGCAGCTGG - Intergenic
943088751 2:183349221-183349243 CAGAGAGCCTGGAGGGAAGCGGG - Intergenic
943961185 2:194265102-194265124 CTGGGGCCATGGATGGCAGCAGG + Intergenic
944201030 2:197107725-197107747 ATGTGGTCCTGGAGGACAGAGGG + Intronic
944361749 2:198865332-198865354 GGGTGGGCAGGGAGGGCAGCTGG - Intergenic
946163034 2:217847643-217847665 CTGAGGCCCTGGAGGGCTGTGGG + Exonic
946219727 2:218216485-218216507 CTGTGGGACGTGGGGGCAGCTGG - Intergenic
946398201 2:219453967-219453989 CCGTAGGCCTGGTGGGGAGCAGG + Intronic
946432904 2:219635051-219635073 CTGGGGGAATGGAGGGCACCTGG + Intronic
946434457 2:219642535-219642557 CTGGGGGACTTGAGGGGAGCGGG + Intergenic
947820910 2:233068866-233068888 CTGGGAGCCTGGAAGCCAGCAGG + Intronic
947838007 2:233189160-233189182 CTGCTGGCCTGGCTGGCAGCGGG - Intronic
947911680 2:233804754-233804776 CAGGTGGCCAGGAGGGCAGCAGG + Intronic
948053571 2:234995574-234995596 CTGTGGGCTTCGAGGACAGGAGG - Intronic
948301168 2:236908613-236908635 CTGTGTGGCTGGAGGGAAGGCGG - Intergenic
948554261 2:238796409-238796431 CTGTGTGGCAGGAGGACAGCTGG + Intergenic
948589376 2:239039445-239039467 CTGTGAGCCTGAAGGTCAGTGGG - Intergenic
948747657 2:240107926-240107948 CCCTGGGCCTGGTGGGCAGGAGG + Intergenic
948762331 2:240199722-240199744 CTGGGGGGCGGGAAGGCAGCCGG - Intergenic
948851663 2:240711323-240711345 CTGGGGGCCTGGCGGGCTCCAGG + Intergenic
948862695 2:240760644-240760666 AGGTGGGGCTGGAGGGCCGCTGG - Exonic
948876356 2:240831847-240831869 GTCAGGGCCTGGAGGGGAGCTGG + Intergenic
948993345 2:241565394-241565416 CAGTGGGCCTGAGGGGCAGAAGG - Intronic
949019743 2:241734525-241734547 GGCTGGGCCTGGAGGGCAGGCGG + Intergenic
1169189798 20:3651342-3651364 TTGTGTGCCTACAGGGCAGCTGG + Intergenic
1169355502 20:4901620-4901642 CAGTGGGAGGGGAGGGCAGCCGG - Intronic
1169674938 20:8142915-8142937 CTCAGGGGCAGGAGGGCAGCTGG - Intronic
1170582391 20:17709276-17709298 ATGTGGACCTGGAGGGCTGGAGG + Intronic
1171042278 20:21776557-21776579 GTGTGGGTCTGGAAGGCAGAAGG + Intergenic
1171177322 20:23062309-23062331 CTGGTGGACTGAAGGGCAGCTGG + Intergenic
1171385082 20:24764438-24764460 CTGTGGGCTTGGAGGTCAGGCGG + Intergenic
1171869562 20:30514231-30514253 CTGTGGGGCTGCAGGGGAGGGGG + Intergenic
1172703380 20:36865546-36865568 CAGTGGGCCGTGAGGGGAGCTGG - Intergenic
1172773521 20:37394802-37394824 CTGTGGGCCTGGGGCTCAGCGGG + Intronic
1174054486 20:47788509-47788531 CTGTGGGCCTGGCGGACACGTGG + Intergenic
1174153275 20:48500974-48500996 CTGTGGACCTGGGGAGGAGCCGG - Intergenic
1174196558 20:48776430-48776452 CTGTGGGAGGGGATGGCAGCTGG + Intronic
1174562080 20:51438558-51438580 GTGTGAGCCTGGAAGACAGCTGG - Intronic
1174575803 20:51536283-51536305 ATGTGGCCCTGGAGGGCAGCAGG - Intronic
1174777712 20:53361055-53361077 CTGGGGGCTGGGCGGGCAGCGGG - Intronic
1175278680 20:57788368-57788390 CAGCGTGGCTGGAGGGCAGCAGG - Intergenic
1175340266 20:58224526-58224548 CAGTGGCCCTGGAGGGAAGCAGG - Intronic
1175385380 20:58591655-58591677 CTGGGGGTCTGGAGGGCTGCAGG - Intergenic
1175525791 20:59632472-59632494 CTGTGGGCTTGGAGTGCTGGTGG + Intronic
1175802323 20:61807886-61807908 CTGTGGGCCTGGCGGGATGCAGG + Intronic
1175899151 20:62353252-62353274 CTGTGGGCCGAGAGGGCGTCAGG + Intronic
1176200608 20:63858624-63858646 ATGTCGGCGTGGAGGGCACCGGG + Intergenic
1176614796 21:9018191-9018213 CTGTGGGCTGGGAGGCCAGCTGG + Intergenic
1176710409 21:10145680-10145702 CTGTGGGCTGGGGGGGCAGCTGG - Intergenic
1178293356 21:31387773-31387795 AGGTGGGCCTGGAGGGAAGCCGG + Intronic
1178351308 21:31874250-31874272 CTGCCGGCCTGAAGGGCAGAGGG - Intronic
1179437682 21:41373576-41373598 CTGTGGGGCTGAAGGGCAGAGGG - Intronic
1179615430 21:42580225-42580247 TGCTGGGCCGGGAGGGCAGCTGG + Intronic
1179615586 21:42581084-42581106 CCATGGCCCCGGAGGGCAGCAGG - Exonic
1179627026 21:42654369-42654391 CGGAGAGCCTGGGGGGCAGCGGG + Intronic
1179712669 21:43272360-43272382 CAGTGAGCCTGGAGGGAGGCAGG + Intergenic
1179787366 21:43737502-43737524 CTGCGGAGCTGGAGGTCAGCGGG + Intronic
1179890312 21:44331822-44331844 ACGTGAGGCTGGAGGGCAGCGGG - Exonic
1179902276 21:44400399-44400421 CTGTGGGGCTGCGGGGCTGCGGG + Intronic
1180022239 21:45135816-45135838 CTGTGGTCCTGGACTGCAGGTGG + Intronic
1180042707 21:45288255-45288277 CTGGGGGCCGGGAGGGCTGACGG + Intergenic
1180294486 22:10872832-10872854 CTGTGGGCTGGGGGAGCAGCTGG - Intergenic
1180312828 22:11253351-11253373 GAGTGGGCCTGGTGGGCACCCGG - Intergenic
1180497292 22:15902246-15902268 CTGTGGGCTGGGGGAGCAGCTGG - Intergenic
1180600538 22:17012537-17012559 CTGTCAGCCTGGAGGAGAGCAGG + Intergenic
1180700722 22:17780246-17780268 CTGTGCATCTGGAGGGCAGAGGG + Intergenic
1180731271 22:17984308-17984330 GTGTTGGCCTGGCTGGCAGCAGG - Intronic
1180844727 22:18974861-18974883 CTGCGGGGCAGCAGGGCAGCGGG + Intergenic
1180954688 22:19736395-19736417 GTGGGGGCCTCGAGGGCAGCTGG + Intergenic
1181022252 22:20109634-20109656 CTGTGGGGCTCAAGGGCAGCAGG + Intronic
1181043229 22:20202769-20202791 CTGTGGGACTGCAGGGGAGACGG + Intergenic
1181056744 22:20263851-20263873 CTGCGGGGCAGCAGGGCAGCGGG - Intronic
1181151688 22:20888458-20888480 ATGGGGGGCTGGAGGGAAGCGGG - Exonic
1181462865 22:23095582-23095604 CTGAGTGCCTCCAGGGCAGCTGG + Exonic
1182290794 22:29278041-29278063 CTGTATGCCTGGGGGGCAGTTGG - Exonic
1182445443 22:30387080-30387102 CTCTGGTCCTGGAGGGCGTCAGG - Exonic
1182623760 22:31631405-31631427 TTGCGTGCCTGGAGGGCAGAAGG - Intronic
1183196746 22:36358691-36358713 CTGTGGGCCTGGACTGGAACAGG - Intronic
1183258340 22:36777583-36777605 AGGTTGGCCTGGAGGGGAGCCGG - Intergenic
1183277798 22:36912220-36912242 CTGTGGGACTGGGAGGCTGCGGG - Intergenic
1183328808 22:37208491-37208513 CTGTGAACCTGGGGGGCAGGTGG + Intronic
1183424960 22:37734512-37734534 CTGATGTCCTGGGGGGCAGCGGG - Exonic
1183469771 22:37999093-37999115 AGGTGGGCCTGCTGGGCAGCTGG + Intronic
1183521658 22:38299196-38299218 CTGTGGGCATGGATGGCTCCTGG - Intronic
1184194557 22:42918152-42918174 CAGTGGCCCTGGTGTGCAGCTGG - Intronic
1184248565 22:43247885-43247907 ATGTGGGCCTGCAGGGCCGGGGG + Intronic
1184352814 22:43955632-43955654 CTCTGGGCCAGCAGGGCAGACGG + Intronic
1184493862 22:44826033-44826055 CTGTGTACCCGGAGGGCAGGGGG - Intronic
1184825173 22:46945678-46945700 CTGTGGGCCTGTACAGGAGCAGG + Intronic
1185019257 22:48364256-48364278 CTATGTGCCGGGAGGGCAACCGG + Intergenic
1185065955 22:48631822-48631844 CAGGGGGCCTAGGGGGCAGCTGG + Intronic
1185208391 22:49553210-49553232 CTGTGGGCAGGGAGGGGAGGAGG + Intronic
1185373092 22:50469866-50469888 CTGTAACCCTGGAGGGCAGATGG - Intronic
949281558 3:2352778-2352800 GTGCGGGACTGGTGGGCAGCAGG + Intronic
950183866 3:10933282-10933304 CTGGGTACCTGGTGGGCAGCTGG - Intronic
950423835 3:12914251-12914273 CATTGGGCCTCAAGGGCAGCTGG - Intronic
950569616 3:13791967-13791989 CTGTGGGCCTGAAGAGGGGCTGG + Intergenic
950625638 3:14244695-14244717 CCATGGGCGTGGAGAGCAGCAGG + Intergenic
951173584 3:19572606-19572628 GTTTGGGGCTGGAGAGCAGCAGG + Intergenic
952211216 3:31231161-31231183 AGATGGGCCTGGAGGGCACCTGG + Intergenic
952764233 3:36941348-36941370 CTGTGAGCCTGGTGGGCTGGTGG - Intronic
953449801 3:42996703-42996725 CTCTGGGCCTAGAGGGGAGATGG - Intronic
953972699 3:47359518-47359540 CTGAGGGTGTGCAGGGCAGCAGG - Intergenic
954217560 3:49132969-49132991 CAGAGGGCCTGGAGGGAAACAGG - Exonic
954684820 3:52364773-52364795 CTGGGCAGCTGGAGGGCAGCTGG + Intronic
955890351 3:63643997-63644019 CTGTGGGCTTGGCAGGCTGCAGG - Intergenic
956757561 3:72404039-72404061 CTGTGATCCTGGTGGGCACCTGG - Intronic
960373878 3:116874640-116874662 ATGAGGGGCTGGAGGGCAGGAGG + Intronic
961512163 3:127409681-127409703 CTGTGGGCTGGGAGGCCAGCAGG - Intergenic
961515581 3:127431775-127431797 CTGTTGGTTTGGAGGTCAGCTGG + Intergenic
961653176 3:128427562-128427584 CTGTGGGCCATGAGGGAGGCTGG - Intergenic
961826482 3:129601817-129601839 CTGAGGGCTTGGAGGGTGGCAGG - Intronic
961867749 3:129966395-129966417 CTGTGGGGCTGGCGTGGAGCTGG - Intergenic
962343733 3:134605241-134605263 CTGTGGCCCTGGAAGCCAGGAGG - Intronic
962344640 3:134610260-134610282 CTGTGTACCTGGAGGGAAGATGG - Exonic
962828352 3:139119143-139119165 CTGTGGCCATGGAGGTCAGGTGG + Intronic
963067456 3:141274754-141274776 CTGTGAGCCATGACGGCAGCAGG + Intronic
965404093 3:168249436-168249458 CTGGGGGCTGGAAGGGCAGCTGG - Intergenic
966775854 3:183542058-183542080 CTGAGGGCCTGCAGGGCAGCCGG - Intronic
966868509 3:184275894-184275916 CGGTGTTGCTGGAGGGCAGCTGG + Intronic
967054864 3:185823543-185823565 GTGGGGGCCGGGAGAGCAGCGGG - Intronic
967099110 3:186201304-186201326 CTGATGGCCTGGGGGCCAGCAGG + Intronic
967324259 3:188223587-188223609 ATTTGTGCCTGGAGGGAAGCTGG + Intronic
968500726 4:948602-948624 CTGCAGGCCTGGAGGTGAGCGGG + Intronic
968689309 4:1982525-1982547 CTGTGGGCCTGGGGACCACCCGG - Intergenic
968698518 4:2043897-2043919 CTGTGTGCCTGCTGGCCAGCGGG + Exonic
968940300 4:3634192-3634214 CTGTGGGCCTGGAGAGCCCCGGG + Intergenic
968951920 4:3699840-3699862 CTGGGGGCCTGGGGAGCACCGGG + Intergenic
969293315 4:6254149-6254171 CTGTCGGCCTGCTGGGCACCTGG - Intergenic
969427671 4:7135211-7135233 CTGTGAGCATGCAGTGCAGCGGG - Intergenic
969622265 4:8284529-8284551 GTGTGGGCATGGAGGCCAGTGGG + Intronic
969657577 4:8507078-8507100 GCCTGGGCCTGGAGGCCAGCAGG + Intergenic
969665982 4:8557897-8557919 CTGTGGGCCAGGGTGGGAGCTGG - Intergenic
969682241 4:8649781-8649803 CTGTGGGGCAGGCGGGCAGCGGG - Intergenic
970689811 4:18609944-18609966 CAGTGGGCCTGGAGAGCAAATGG + Intergenic
971393241 4:26205103-26205125 CTGTGCTCCTGGTGGCCAGCGGG - Intronic
971884253 4:32423388-32423410 CTGAGGCCCTGAAGGGCAGGAGG + Intergenic
972296623 4:37745479-37745501 CAGTGGGGCTGGTGGGCAACTGG - Intergenic
972375145 4:38462836-38462858 CTTTGGGCCTAGCAGGCAGCTGG - Intergenic
972731873 4:41802728-41802750 CTTAAGCCCTGGAGGGCAGCTGG - Intergenic
975113305 4:70650738-70650760 CTGTGAGCCTTCAGGGAAGCTGG - Intronic
976408094 4:84682017-84682039 ATGTGGGGCTGGGGTGCAGCAGG + Intronic
976647320 4:87399828-87399850 CTGTGGGCATTGTGGACAGCAGG + Intergenic
977408913 4:96636487-96636509 CTGTCTGCCTGAAGGGTAGCCGG + Intergenic
978924895 4:114231460-114231482 CTTTTGGGCTGGAGGGCTGCAGG + Intergenic
980959807 4:139463831-139463853 GTGCAGGCCTGGAAGGCAGCAGG + Intronic
983964455 4:173792461-173792483 CTGTGGGCTTTGAGGGCAGAGGG + Intergenic
985537625 5:473731-473753 CTGGGGGCCTGGGAGGCACCCGG - Intronic
985640805 5:1062705-1062727 CTGGGGGACTGGGGGGCTGCGGG + Intronic
985959299 5:3287679-3287701 CTGTGGGCCTGCAGGACACTGGG + Intergenic
986221861 5:5775543-5775565 GTGTGGGCCTGGAGGTAAGAGGG + Intergenic
986549444 5:8936126-8936148 GTGTGTGCCTGCAGTGCAGCAGG - Intergenic
986591426 5:9374838-9374860 CAGTGAGCCTGGAGGGCAGGAGG - Intronic
986613929 5:9597506-9597528 GTGTGGACCTTGAGGGCGGCTGG - Intergenic
986614022 5:9598514-9598536 GTGTGGACCTTGAGGGCGGCTGG - Intergenic
988548192 5:32176689-32176711 GGGTGGGGGTGGAGGGCAGCTGG + Intergenic
989570205 5:42938961-42938983 CTGTTTGCCTGGAGGCCAGCAGG - Intergenic
992050566 5:72936706-72936728 CTGTAGGCCAGGAGCTCAGCTGG + Intergenic
992507208 5:77398691-77398713 CTGTGGCCCGGAAGGGCAGCAGG - Intronic
994570326 5:101506282-101506304 GTGTGGGCATGGTGGGCTGCAGG - Intergenic
995034557 5:107518490-107518512 CTGGGGGACTGGTGGGCAGAAGG + Intronic
996599791 5:125249545-125249567 CTCTGTGCCTGGACTGCAGCAGG - Intergenic
997459467 5:134042242-134042264 CTGTGGGCTTGGGGGGGACCAGG + Intergenic
997519256 5:134512186-134512208 CTCTAGGCCTGCAGGGAAGCTGG - Intergenic
998139279 5:139690714-139690736 CTGGGGGCCATGAGGGCTGCGGG - Intergenic
1000064714 5:157684566-157684588 CTGTGGCCCTGGAGAGGAGGAGG - Intergenic
1000336782 5:160247170-160247192 CTTTGAACCTGGAGGGCAGAAGG + Intergenic
1001420812 5:171585929-171585951 CTGTTGGTCTGTAGGTCAGCTGG + Intergenic
1001663050 5:173411025-173411047 CTCTGGAGCTGGAGGGCGGCTGG - Intergenic
1001980689 5:176035495-176035517 CTGTGGCCCTGGTGGGGGGCTGG - Intergenic
1002101084 5:176857979-176858001 TCGTGGGCCTGCAGGACAGCAGG - Intronic
1002183432 5:177442982-177443004 AGGTGGGCCTGGAGGGAAGCAGG + Intergenic
1002236772 5:177808570-177808592 CTGTGGCCCTGGTGGGGGGCTGG + Intergenic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002312083 5:178320862-178320884 CTGTGGGCCTGGAGGTCGCATGG + Intronic
1002421718 5:179152498-179152520 CAGGGAGCCTGGCGGGCAGCTGG + Intronic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1002613754 5:180437561-180437583 CTGTGGGCCTGGCGTGGTGCTGG + Intergenic
1002992001 6:2246389-2246411 CTCAGAGCCGGGAGGGCAGCAGG + Intergenic
1003139079 6:3456505-3456527 CGGCGGGCCTGGGCGGCAGCCGG - Exonic
1004510269 6:16278974-16278996 CTGTGGGCATGGGAGGGAGCTGG + Intronic
1004620509 6:17326703-17326725 CTGAGGGCCTGGAGGCCAGGAGG + Intergenic
1004895253 6:20141799-20141821 CGGTGGGCATGAAGGGCAGCGGG + Intronic
1005758616 6:28947788-28947810 CTGGGAACCTGGAGGGCAGGAGG - Intergenic
1006093949 6:31644379-31644401 CAGGGGGCAGGGAGGGCAGCTGG + Intronic
1006100427 6:31683012-31683034 CCGTGGGCCTTGAGGGAACCGGG + Intronic
1006113568 6:31763270-31763292 CTGAGGACCTGGAGGGCAAGGGG - Intronic
1006474989 6:34247751-34247773 CTGTTGGCCTGGGGGGCATTGGG + Exonic
1007820690 6:44558671-44558693 CTAAGGGGCTGGAGGGCACCAGG - Intergenic
1008508716 6:52256215-52256237 ATGTGGGGCTGGAGAGCAGATGG - Intergenic
1009883938 6:69602372-69602394 CTTTGGGCCAGGAGGCCGGCAGG + Intergenic
1011704349 6:89985952-89985974 GTGTGGGGCTGGAGGGATGCGGG + Intronic
1011786692 6:90854421-90854443 CTGTGGTCCAGGAGAGCAGGTGG + Intergenic
1012052608 6:94362548-94362570 CTCTGGGCCTGGAGGGGGGTGGG + Intergenic
1013658497 6:112270384-112270406 CAGTGTGTCTGGTGGGCAGCTGG + Intergenic
1013954995 6:115831498-115831520 CTGTGGGCCTGCAGGGCTGATGG - Intergenic
1015147670 6:130005590-130005612 CTGTGGGGCAGGAGGGCAGTGGG + Intergenic
1016631093 6:146232659-146232681 TTGGGGGGCTGGAGGGCAGGTGG - Intronic
1017526547 6:155246226-155246248 GCGTGGGCCTGGAGGGCATCTGG + Intronic
1017588569 6:155953692-155953714 CTGTGGAAGTGGAGGGGAGCTGG + Intergenic
1017677547 6:156829330-156829352 CTGTGGGCCTGGAGGGCCATAGG - Exonic
1017749685 6:157479797-157479819 CTCTGGGCCAGGAGGGGACCAGG - Intronic
1017820605 6:158046385-158046407 CAGGGGGCCGGGAGGGCAGCGGG + Intronic
1018767353 6:166944854-166944876 GTGTGGGCCTGGTGGGCAGAGGG - Intronic
1018923898 6:168193762-168193784 ATATGGGCCTGGTGGGCAGGAGG + Intergenic
1019017619 6:168891312-168891334 CTCTTGTCCTGGATGGCAGCAGG - Intergenic
1019191692 6:170254871-170254893 CTGTGGGCCTGGTGGGCACCAGG + Intergenic
1019215224 6:170438932-170438954 CTGAGGGCCTAGGGGTCAGCAGG + Intergenic
1019286720 7:226963-226985 GTGTGGGCTTGGACGGCTGCAGG - Intronic
1019415392 7:924539-924561 GCGTGGACCTGGAGGGCAGGGGG - Intronic
1019558744 7:1645496-1645518 CTGTGGGCCCGGAGGCCAGCGGG - Intergenic
1019645168 7:2125034-2125056 GTGTGGGCCGGGAGCCCAGCAGG - Intronic
1019649350 7:2148374-2148396 CTGTGGGGCTGGTGGGCAGTGGG - Intronic
1019996532 7:4728089-4728111 CCCTGGCCCTGGATGGCAGCCGG + Intronic
1020437149 7:8176561-8176583 CTTTGTGCCTCGTGGGCAGCAGG + Intronic
1020882510 7:13779596-13779618 CTGTGTGCCTGTATGGGAGCTGG - Intergenic
1021033230 7:15764434-15764456 CTGGGTGCCTGGAGTTCAGCTGG + Intergenic
1022511638 7:30938570-30938592 CTGTGGCTCTGCAGGGCTGCAGG - Intergenic
1023829678 7:44031510-44031532 CTGTCTGCCTGGAAGGGAGCAGG + Intergenic
1024089657 7:45924730-45924752 CTGTGTGCCTGGAGGGACGAGGG + Intergenic
1024971969 7:55079047-55079069 CCGTGGGCCGGGCAGGCAGCAGG + Intronic
1026120476 7:67532499-67532521 CTGTGGCCCTGAAGGGACGCAGG + Intergenic
1026463116 7:70631965-70631987 CTGCCGTCCTGGTGGGCAGCAGG + Intronic
1026903266 7:74048579-74048601 CTAGGGGCCTGGAGGCCACCAGG - Intronic
1026944227 7:74306041-74306063 TGGTGGGGCTGGAAGGCAGCAGG - Intronic
1027235043 7:76293134-76293156 AGGGGGGCCTGGAGGCCAGCAGG - Intergenic
1029269832 7:99370491-99370513 CTGTGGGACGGGTGGGCAGGTGG + Intronic
1029489224 7:100861369-100861391 CTGCGGGCATGGAGGGGAGGAGG - Intronic
1029595523 7:101535637-101535659 CTGTGTGCCTCGAGGGCTGGAGG + Intronic
1029601118 7:101563959-101563981 CTGTGAGCCAGGAGGGGACCTGG - Intergenic
1029737479 7:102472778-102472800 GTGGGGGCCTGCAGGGCTGCCGG - Exonic
1029739988 7:102485769-102485791 CTGTCTGCCTGGAAGGGAGCAGG + Intronic
1029757985 7:102584948-102584970 CTGTCTGCCTGGAAGGGAGCAGG + Intronic
1032002871 7:128276660-128276682 CTGAGAGCCTGGAGAGCAGGAGG + Intergenic
1032331325 7:130983216-130983238 CTGAGGGGCTGAAGGGGAGCTGG + Intergenic
1032792747 7:135254382-135254404 CTGTGTGTCTGTAGGACAGCTGG - Intronic
1033306591 7:140230292-140230314 CGGTGGACGTGCAGGGCAGCGGG + Intergenic
1034153485 7:148935575-148935597 TTGTAGGCCTGGAGGGCCTCAGG - Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034309140 7:150071647-150071669 CTGTGGGCCTCGAGGACAGAGGG + Intergenic
1034536673 7:151729705-151729727 CTGCGGGGCTGGACGGCAGCAGG - Intronic
1034797715 7:154028989-154029011 CTGTGGGCCTCGAGGACAGAGGG - Intronic
1034820202 7:154210202-154210224 CTGAGGGCCTGAAGGAGAGCAGG - Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1034978884 7:155463336-155463358 CTGCGGGCCTGGGCGGCTGCTGG - Exonic
1035253457 7:157612070-157612092 CTCTGGGCCTGGAGGGCTGCAGG - Intronic
1035624493 8:1060804-1060826 CTGTGGGCCTGGGAGGAGGCAGG + Intergenic
1036207891 8:6818776-6818798 CTGGGGGCCTCCAGTGCAGCTGG - Intronic
1037787876 8:21913093-21913115 CTGGGGGCCTGGACCCCAGCCGG - Intronic
1038307749 8:26420052-26420074 TGGTGGGCGTGGAGGGCAGGAGG - Intronic
1039611737 8:38924508-38924530 CTGTGGGCCTGCAGGAGCGCTGG + Intronic
1039845316 8:41321612-41321634 CGGTGGGGCTGGAGAGCAGAGGG + Intergenic
1039895516 8:41714089-41714111 CTGAGGGACTGGAAGGTAGCAGG + Intronic
1040492975 8:47941984-47942006 GCGTGGGCCTGCAGGGAAGCCGG - Intronic
1040543122 8:48377069-48377091 CTGTGGGGCCTGAGGGAAGCTGG + Intergenic
1040546763 8:48404053-48404075 CTACGGGCCTGGAGGGCAGAGGG - Intergenic
1042874097 8:73424947-73424969 CTTTGGACCTGGAGTGCTGCAGG + Intronic
1043214981 8:77574355-77574377 CTGTGGGCCTGGGGTGGAGGTGG + Intergenic
1043350651 8:79356890-79356912 CTGTTGGCCTGCAGATCAGCTGG - Intergenic
1043511068 8:80950647-80950669 CTGGAGGCCAGGAGGGCGGCAGG + Intergenic
1047480776 8:125280929-125280951 CTGTAGGTTTGTAGGGCAGCAGG - Intronic
1047861663 8:128973565-128973587 CTGTGGGCCTGGTGGTAGGCTGG - Intergenic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1048446094 8:134494355-134494377 TTGTCAGCCTGAAGGGCAGCAGG + Intronic
1048508670 8:135043070-135043092 CTGAGGACCTCCAGGGCAGCAGG + Intergenic
1048510179 8:135055004-135055026 CGGTGGGGCTGGGGGGAAGCTGG - Intergenic
1048979028 8:139693236-139693258 CTGTGAGTCTGCAGGGCATCTGG - Intronic
1049298540 8:141856598-141856620 CTGTGGGCTGGAAGGGCAGGAGG + Intergenic
1049300425 8:141866753-141866775 CTGTGGGGCAGGTGAGCAGCAGG + Intergenic
1049325203 8:142017993-142018015 CAGTAGCCATGGAGGGCAGCTGG - Intergenic
1049326095 8:142022341-142022363 CTGTGGGCCTGGTGGGGGGTCGG - Intergenic
1049432467 8:142571676-142571698 CTGTGGGCCTGTGGGGGAGCGGG - Intergenic
1049473687 8:142787355-142787377 CTGGGGCCCTGGAGGGCGGGAGG - Intergenic
1049586702 8:143435720-143435742 CTGTGTGCCTGGAGGGGTGCCGG - Intergenic
1049647377 8:143741575-143741597 CTGTGTCCCTTGAGAGCAGCAGG + Intergenic
1049687770 8:143945821-143945843 GTGTGGGGCTGGAGAGCAGGAGG - Intronic
1049850078 8:144826328-144826350 CTGGGGGTCTGGAGGGCGGCTGG + Intergenic
1050587741 9:7130659-7130681 CTGTTGCCCTGGAGGGGGGCAGG + Intergenic
1050970927 9:11872594-11872616 CTGTGAGCCTGGAGAACAGATGG + Intergenic
1051392584 9:16581842-16581864 CTGTGGGCATGAAGGACTGCAGG + Intronic
1052707556 9:32011120-32011142 CTGTGGGACTGGCAGCCAGCTGG - Intergenic
1052877077 9:33575368-33575390 ATCTGGGGCTGCAGGGCAGCTGG - Intergenic
1052971697 9:34380794-34380816 CTGGGGGCCTGCACGGAAGCTGG + Intronic
1053354126 9:37432168-37432190 CACTGGTCCTGCAGGGCAGCAGG - Intronic
1053498928 9:38569026-38569048 ATCTGGGGCTGCAGGGCAGCTGG + Intronic
1053647389 9:40131378-40131400 CTGTGGGCTAGGGGGGCAGCTGG - Intergenic
1053662269 9:40292273-40292295 ATCTGGGGCTGCAGGGCAGCTGG - Intronic
1053758338 9:41332465-41332487 CTGTGGGCTAGGGGGGCAGCTGG + Intergenic
1053912720 9:42922440-42922462 ATCTGGGGCTGCAGGGCAGCTGG - Intergenic
1054328377 9:63729332-63729354 CTGTGGGCTAGAGGGGCAGCTGG - Intergenic
1054450458 9:65401105-65401127 CTGTGGGCCTGGAGGGCCCCGGG - Intergenic
1054451246 9:65404537-65404559 ATAGGGTCCTGGAGGGCAGCAGG - Intergenic
1054522341 9:66084011-66084033 ATCTGGGGCTGCAGGGCAGCTGG + Intergenic
1054537190 9:66244792-66244814 CTGTGGGCTAGGGGGGCAGCTGG + Intergenic
1054761476 9:69008145-69008167 CTGTGCACTTGGAGGGCAGGAGG + Intronic
1056280947 9:85040790-85040812 CTGTGTCCCAAGAGGGCAGCGGG - Intergenic
1056586515 9:87930987-87931009 ATCTGGGGCTGTAGGGCAGCTGG + Intergenic
1056610363 9:88121955-88121977 ATCTGGGGCTGTAGGGCAGCTGG - Intergenic
1056757388 9:89390362-89390384 CTGCGGGGCTGCGGGGCAGCTGG + Intronic
1057161974 9:92895333-92895355 ATGTGGGGCTGCCGGGCAGCTGG + Intergenic
1057678375 9:97153518-97153540 ATCTGGGGCTGCAGGGCAGCTGG + Intergenic
1057951352 9:99371248-99371270 TTATGGGCCTGAATGGCAGCGGG - Intergenic
1059976524 9:119723852-119723874 CTCAGGCTCTGGAGGGCAGCAGG + Intergenic
1060150920 9:121287515-121287537 CTGTGGACCAGGTGTGCAGCAGG - Intronic
1060376231 9:123117234-123117256 CTGTAATCCTGGAGGGGAGCAGG - Intronic
1060549118 9:124476865-124476887 CTGGGGGCCTGGCGGGGACCAGG + Intronic
1060934136 9:127506037-127506059 CTGTGGGCCAGGCGGGCAGGAGG + Exonic
1061221916 9:129257147-129257169 CTCTGAGCCTGGAGGCCAGAAGG - Intergenic
1061369817 9:130191948-130191970 ATGGGGGGCTGGAGGGCAGAAGG + Intronic
1061532898 9:131228774-131228796 CTGGGGGGCTGCAGGGGAGCAGG - Intronic
1061813974 9:133182177-133182199 CTGGGGGCCTGGTGGCCAGATGG + Intergenic
1061828464 9:133275638-133275660 CTGCGGGGCTGGAGGGCTACAGG - Intergenic
1061856699 9:133445454-133445476 CTGTGGGCCTGGCCGAGAGCTGG - Intronic
1062050941 9:134446717-134446739 CTGGGGGGCTGGGGGGCTGCTGG + Intergenic
1062198325 9:135287012-135287034 CTGGGGGGCTGGAGCGCTGCAGG - Intergenic
1062207817 9:135346958-135346980 CCGGGGGGCTGGATGGCAGCTGG - Intergenic
1062315073 9:135963091-135963113 CTGTGGGAGGGGAGGCCAGCAGG + Intergenic
1062345212 9:136111285-136111307 GTGTGGGCAGGGAGGGCCGCTGG - Intergenic
1062421275 9:136483774-136483796 CTGGGAGGCTGGAGGGCAGGCGG + Exonic
1062541116 9:137041979-137042001 GTGGGGGCCTGGAGGGCTTCTGG + Intronic
1062544560 9:137055660-137055682 CGCTGGGCCTGGAGGGAAGCGGG - Intergenic
1062570532 9:137183045-137183067 TCGTGGTCCTGGGGGGCAGCCGG - Intronic
1202795173 9_KI270719v1_random:114675-114697 CTGTGGGCTGGGGGGGCAGCTGG - Intergenic
1203771939 EBV:53932-53954 CTTTGGGCGGGGAGGGAAGCAGG + Intergenic
1186776363 X:12868581-12868603 CAGTGGCCCTGGAAGGCAACAGG - Intronic
1186795476 X:13043790-13043812 CCGTGGGCAGGAAGGGCAGCAGG - Exonic
1188963041 X:36516933-36516955 TTGTGGGACTGGAGGGGAGGTGG + Intergenic
1189269253 X:39739316-39739338 CTGTGGGCGTTGAGCGCAGTGGG + Intergenic
1189280311 X:39816387-39816409 CTGTGGGCCTAGAGGCAGGCAGG + Intergenic
1189322831 X:40096932-40096954 CGGTGGGCCAGGAGGAGAGCAGG - Intronic
1189381423 X:40505208-40505230 GTGGGGGCCTGGAGGGCTGTGGG + Intergenic
1190039522 X:47058602-47058624 CCAATGGCCTGGAGGGCAGCTGG + Exonic
1190119754 X:47650395-47650417 CTCTGGGCCTGGAGGGTGGAGGG - Intronic
1190255849 X:48761799-48761821 CTGGCAGCCTGGAGGGCAGATGG - Exonic
1190322028 X:49185135-49185157 CTGTGGAACTGGAGTGCTGCTGG - Intronic
1190455126 X:50619489-50619511 CTGTGGGCCCGGGGGCAAGCAGG - Intronic
1192329141 X:70160099-70160121 CTTTGGCCCAGGGGGGCAGCTGG - Intronic
1192788049 X:74354063-74354085 CTGTGGCCATGGAGGCCAGCTGG - Intergenic
1193644263 X:84047597-84047619 CAGTGGGCTTGGAGGGGAGTGGG - Intergenic
1195900354 X:109791083-109791105 CTGTGGAACTTGAGGGCAACGGG - Intergenic
1198684308 X:139211572-139211594 CTGTGGGGGTGGGGGGTAGCGGG - Intronic
1199864111 X:151827636-151827658 CTGTGGGCCTGGAAGGAAGGAGG - Intergenic
1200051263 X:153433096-153433118 CTGTGTGGCTGGAGGCCAGTGGG + Intergenic
1200149679 X:153944957-153944979 CTGTGGGGCAGGGGTGCAGCAGG + Intergenic
1200247713 X:154534772-154534794 CTGAAGGCCTGTAGGGGAGCAGG + Intronic
1200690913 Y:6305983-6306005 CTGTGGGCCTTCCGGGGAGCGGG + Intergenic
1201044359 Y:9868733-9868755 CTGTGGGCCTTCCGGGGAGCGGG - Intergenic
1201400476 Y:13599229-13599251 CTGAGGCTCTGGAGGGCAACAGG - Intergenic