ID: 919736808

View in Genome Browser
Species Human (GRCh38)
Location 1:200957762-200957784
Sequence CTTACAGTGTAGTGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919736798_919736808 30 Left 919736798 1:200957709-200957731 CCCTTGGAGATTGCTGTCATCAT No data
Right 919736808 1:200957762-200957784 CTTACAGTGTAGTGGGAGGAGGG No data
919736799_919736808 29 Left 919736799 1:200957710-200957732 CCTTGGAGATTGCTGTCATCATC No data
Right 919736808 1:200957762-200957784 CTTACAGTGTAGTGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919736808 Original CRISPR CTTACAGTGTAGTGGGAGGA GGG Intergenic
No off target data available for this crispr