ID: 919740368

View in Genome Browser
Species Human (GRCh38)
Location 1:200977538-200977560
Sequence ACTAGAGTGGAGCTCTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 102}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919740368_919740377 20 Left 919740368 1:200977538-200977560 CCAGGGGAGAGCTCCACTCTAGT 0: 1
1: 0
2: 0
3: 4
4: 102
Right 919740377 1:200977581-200977603 ATGTGGCCTGCCCATGTGCCTGG No data
919740368_919740379 27 Left 919740368 1:200977538-200977560 CCAGGGGAGAGCTCCACTCTAGT 0: 1
1: 0
2: 0
3: 4
4: 102
Right 919740379 1:200977588-200977610 CTGCCCATGTGCCTGGTCACTGG 0: 1
1: 0
2: 4
3: 23
4: 221
919740368_919740373 3 Left 919740368 1:200977538-200977560 CCAGGGGAGAGCTCCACTCTAGT 0: 1
1: 0
2: 0
3: 4
4: 102
Right 919740373 1:200977564-200977586 CTATGAGTCAACTCCCCATGTGG 0: 1
1: 0
2: 0
3: 7
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919740368 Original CRISPR ACTAGAGTGGAGCTCTCCCC TGG (reversed) Intronic
900646509 1:3711207-3711229 ACGTGTGTGGAGCGCTCCCCAGG - Intronic
902455438 1:16530575-16530597 TCTAGAGTAGAGCTCTTCCGTGG + Intergenic
902496732 1:16877313-16877335 TCTAGAGTAGAGCTCTTCCGTGG - Intronic
902623806 1:17665245-17665267 CCTGGAGTGGAGCTCTCCCAGGG + Intronic
902878056 1:19352894-19352916 AGGAGAGTGGCGCTCTGCCCCGG + Intronic
905919502 1:41710063-41710085 ACTTGAGTAGAGCTCTCTTCGGG - Intronic
917928451 1:179807683-179807705 TCTAGAGTGGAAGTCTCTCCAGG - Intronic
919740368 1:200977538-200977560 ACTAGAGTGGAGCTCTCCCCTGG - Intronic
923273746 1:232379424-232379446 ACAAGAGTGCAGCTGTCCCTAGG - Intergenic
1062898275 10:1121656-1121678 ACTAGAGCAGACCCCTCCCCAGG - Intronic
1063458413 10:6201246-6201268 AGTGGAGTGGGACTCTCCCCTGG + Intronic
1067186522 10:44032962-44032984 ACCAGAGTGGAGATCTGGCCAGG + Intergenic
1069112799 10:64468048-64468070 ACTAGATTGCAGCTCTCACTTGG + Intergenic
1069133853 10:64739811-64739833 ATTAGACTTGAGCTATCCCCAGG - Intergenic
1070381555 10:75884932-75884954 CCTGGACTGGAGTTCTCCCCAGG - Intronic
1074194191 10:111166395-111166417 AGGAGAGGGGAGCTCTCACCTGG - Intergenic
1074843535 10:117376690-117376712 GCTAGAGAGGAGCCCTGCCCTGG - Intergenic
1088422884 11:109668389-109668411 ACAATAGTGGTGCTATCCCCAGG + Intergenic
1089270735 11:117299983-117300005 ACTGGAGTGGAGCTTTGACCTGG + Intronic
1091442450 12:521932-521954 CCTGGAGTAGGGCTCTCCCCAGG - Intronic
1103738951 12:123078498-123078520 ACTAAAGTGACCCTCTCCCCGGG + Intronic
1104834174 12:131776663-131776685 GCTGGGCTGGAGCTCTCCCCGGG + Intronic
1111198109 13:84899161-84899183 ACTGGAGTGGAGCCCTAGCCAGG + Intergenic
1112160596 13:96863316-96863338 ACTAGAATGGATTTCTTCCCAGG - Intergenic
1112924812 13:104661102-104661124 AATAGAGGTGAGGTCTCCCCAGG - Intergenic
1115370570 14:32609451-32609473 ACTAGATTGGAGGTCCCGCCGGG + Intronic
1119180334 14:72600892-72600914 ACTTGACTGTAGCCCTCCCCTGG + Intergenic
1121614993 14:95307746-95307768 ACAAGCGTGGAGCTCTCTCTTGG - Intronic
1123010834 14:105348820-105348842 ACTCGAGGGCAGCTCTGCCCTGG - Intronic
1126842966 15:52734969-52734991 AATTGAGTGGAGCTCCTCCCAGG + Intergenic
1127308173 15:57728343-57728365 GCTAGAGAGGGGCTCTACCCTGG - Intronic
1127375288 15:58378746-58378768 TCCAGAGTGGAACTCTCTCCCGG + Intronic
1128275756 15:66352479-66352501 AGTAGAGTTGAGGTCTCGCCAGG + Intronic
1128879429 15:71229711-71229733 ACTCGAGTAGAGATCTCTCCTGG + Intronic
1133680083 16:8113137-8113159 ACAACAGTGTTGCTCTCCCCGGG - Intergenic
1134729367 16:16448067-16448089 ACTAAAGCAGACCTCTCCCCAGG + Intergenic
1134938066 16:18263791-18263813 ACTAAAGCAGACCTCTCCCCAGG - Intergenic
1138555003 16:57765854-57765876 ACTGGGGTGGAGCTCTGCCTTGG + Intronic
1140748189 16:77999465-77999487 CCAAGAGTGGAGCCCTCACCAGG + Intergenic
1143277105 17:5720142-5720164 TCTAGAGGGGAGCTCTGCCAAGG + Intergenic
1148892905 17:50820640-50820662 ACGAGGGTGGAGCCCTCGCCAGG - Intergenic
1150535552 17:66035724-66035746 ACTAATGTGCAGCTCTCTCCTGG + Intronic
1151364960 17:73611372-73611394 ACCAGTGTGGAGCACGCCCCAGG + Intronic
1151547982 17:74805156-74805178 ACCAGAGTAGGCCTCTCCCCGGG - Intronic
1156654670 18:39271229-39271251 ACTAGAAATGAGCTCTCCCAGGG + Intergenic
1157770099 18:50338233-50338255 ACCAGAGTGTAGCTCTAGCCAGG + Intergenic
1162391936 19:10395207-10395229 AGGTGAGTGGAGCTTTCCCCGGG - Exonic
1167264268 19:48475651-48475673 ACTAGAGTGGTTCTCAGCCCTGG + Intronic
1202706328 1_KI270713v1_random:26951-26973 TCTAGAGTAGAGCTCTTCCGTGG + Intergenic
926048453 2:9727559-9727581 ACCAGAGAGGAGCTCACCCCTGG + Intergenic
926142276 2:10374855-10374877 ACCAGAGTGGAGAACTCCCTGGG + Intronic
927465324 2:23332186-23332208 ATTAGAATGGGGCTCTCCCGGGG - Intergenic
932618737 2:73253107-73253129 ACTCTAGTGGAGCTCACCCCAGG - Intergenic
945039669 2:205733449-205733471 ACTGGAGTGAAGCCCTCACCTGG + Intronic
946246872 2:218392909-218392931 ACTACAGAGGATCTCTCCTCTGG + Intronic
1175616374 20:60403238-60403260 AACAGAGTCGAGCTCTCCCTTGG + Intergenic
1178732406 21:35116951-35116973 ACTACAGTTGAGCCCTTCCCTGG - Intronic
1180086557 21:45510326-45510348 CCTAGAGGGGAGCTCCCCGCTGG - Intronic
1185388771 22:50548096-50548118 AGGAGAGTGTGGCTCTCCCCAGG + Exonic
950090182 3:10289609-10289631 ACAGGAGTTGAGCTCTGCCCTGG - Intronic
954866392 3:53733194-53733216 CCTAGAATGGAGCTCCTCCCAGG - Intronic
955403060 3:58607312-58607334 CCTAGAGTGGAGTTTTCTCCTGG + Intronic
958002009 3:87762167-87762189 TCGAGAGTGGAGCCCTCGCCAGG + Intergenic
960057688 3:113286794-113286816 CCTGGAATGCAGCTCTCCCCGGG + Exonic
960771965 3:121203840-121203862 AGGGGAGTGGATCTCTCCCCTGG + Intronic
961565613 3:127761395-127761417 ACCAGGGTGGAGGCCTCCCCAGG + Intronic
969158049 4:5230529-5230551 TATAGAGTGGAGTTCTCCACAGG - Intronic
970337251 4:15061164-15061186 TCTAGTGTGGACCTCTCCCATGG - Intronic
972918379 4:43906799-43906821 CCTAGGGTGGAGCCCTCACCAGG - Intergenic
974088727 4:57288448-57288470 ACCAGAGTGGATCCCTCCCGAGG + Intergenic
974164954 4:58190411-58190433 ACTAGAGTGCAGCTCCCACTTGG + Intergenic
978387608 4:108191560-108191582 ACTAGAGTAGACTTCTCCACAGG - Intergenic
981430583 4:144654406-144654428 TCTAGAGTGGAGCTTTCATCTGG - Intronic
982176541 4:152710344-152710366 ACTAGAGTGGAGCCCAGCCTTGG + Intronic
984790159 4:183607736-183607758 CCAAGGGTGGAGCTCTCGCCAGG + Intergenic
985228087 4:187784364-187784386 TCGAGAGTGAAGCTCTCACCAGG - Intergenic
985574970 5:669771-669793 ACGGGCGGGGAGCTCTCCCCAGG + Intronic
986165338 5:5267806-5267828 CCGAGAGTGGAGCCCTCACCAGG + Intronic
987130015 5:14851417-14851439 AAAAGAGTGGGGCTGTCCCCAGG - Intronic
990167627 5:53012113-53012135 ACTAGAGTGGAGATTCCCTCAGG + Intronic
990510889 5:56488065-56488087 ACTAGCGGGCAGCTCTGCCCGGG + Intergenic
997765857 5:136502232-136502254 ACTAGATTGCAGCTCTCACTCGG - Intergenic
997978241 5:138452942-138452964 GCTAGAGCGCAGCTCCCCCCAGG + Intergenic
1001284499 5:170412663-170412685 ACTAGAATGCAGCTTTCTCCAGG + Intronic
1006365063 6:33610398-33610420 ACAAGACTGGAGCTCTCCCAAGG - Intergenic
1007306681 6:40912241-40912263 ACTATACTGGAGCTCTGCCAAGG - Intergenic
1007854847 6:44845504-44845526 CCTAGGGTGGAGCCCTCACCAGG - Intronic
1011162844 6:84411270-84411292 AATACCTTGGAGCTCTCCCCTGG - Intergenic
1017215562 6:151901924-151901946 ACTAGATTGCAGCTCTCACTTGG - Intronic
1019039943 6:169095454-169095476 ACAAGAGTGGAGCTCTGCTGAGG + Intergenic
1027336123 7:77152381-77152403 ACTAAAGTGGAGATCTGCCAAGG + Intronic
1029506338 7:100966015-100966037 CCTACAGTGGAGCCCTGCCCTGG + Intronic
1030585673 7:111415352-111415374 ACTAAAGTCAAGGTCTCCCCTGG - Intronic
1031612887 7:123847125-123847147 ACTAGACTGCAGCTCTCACGTGG - Intronic
1036178211 8:6559762-6559784 ACTAGTGTGAACCTCTGCCCTGG - Intronic
1037175837 8:15945116-15945138 CCAAGGGTGGAGCTCTCGCCAGG - Intergenic
1039587361 8:38718493-38718515 ACTTGAATGCAGCTCTCACCTGG - Intergenic
1040442822 8:47462445-47462467 ACTAGATTGCAGCCCTCACCCGG - Intronic
1041781651 8:61583813-61583835 AATAGAGTGGATTTTTCCCCAGG - Intronic
1044448231 8:92302773-92302795 CCAAGAGTGGAGCCCTCTCCAGG + Intergenic
1052185438 9:25588303-25588325 TCTAGTGTGGACCTCACCCCTGG - Intergenic
1054863158 9:69973854-69973876 ACTAGAGTAGAAGTCTCTCCAGG - Intergenic
1058843513 9:108933815-108933837 ACGGGAGTGGACCTCTCCGCCGG - Intronic
1062537197 9:137026284-137026306 CCCAGGGTGGAGCTCTGCCCAGG + Intronic
1187516303 X:19974388-19974410 GCTAGAGTGGGGCCCACCCCAGG - Intergenic
1192905373 X:75545244-75545266 ACCAGAGTGCAGCTCTCGCTTGG - Intergenic
1195131983 X:101862253-101862275 ACTAGAGGGAAGCTCTTGCCAGG + Intergenic