ID: 919740389

View in Genome Browser
Species Human (GRCh38)
Location 1:200977644-200977666
Sequence GGGTGTGAACATGGATCTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 130}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919740381_919740389 29 Left 919740381 1:200977592-200977614 CCATGTGCCTGGTCACTGGCTTG 0: 1
1: 0
2: 1
3: 24
4: 250
Right 919740389 1:200977644-200977666 GGGTGTGAACATGGATCTTCCGG 0: 1
1: 0
2: 0
3: 9
4: 130
919740383_919740389 22 Left 919740383 1:200977599-200977621 CCTGGTCACTGGCTTGGAAAGAT 0: 1
1: 0
2: 1
3: 10
4: 156
Right 919740389 1:200977644-200977666 GGGTGTGAACATGGATCTTCCGG 0: 1
1: 0
2: 0
3: 9
4: 130
919740380_919740389 30 Left 919740380 1:200977591-200977613 CCCATGTGCCTGGTCACTGGCTT 0: 1
1: 0
2: 0
3: 36
4: 314
Right 919740389 1:200977644-200977666 GGGTGTGAACATGGATCTTCCGG 0: 1
1: 0
2: 0
3: 9
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919740389 Original CRISPR GGGTGTGAACATGGATCTTC CGG Intronic
914513228 1:148352685-148352707 GAATGTGAACATGACTCTTCTGG + Intergenic
917741493 1:177965799-177965821 GGGTCTGAACATGGCTCCTTTGG + Intronic
918059946 1:181052479-181052501 CGGTGTCCACATGGTTCTTCAGG + Exonic
919740389 1:200977644-200977666 GGGTGTGAACATGGATCTTCCGG + Intronic
1065641696 10:27788815-27788837 GGGTATGCAAATGAATCTTCTGG - Intergenic
1067272955 10:44808294-44808316 GTGTGGGTACATGGATATTCAGG - Intergenic
1067580501 10:47442635-47442657 GGGTGTGAAGAGGGGGCTTCAGG - Intergenic
1070648003 10:78214819-78214841 GGGTGAGACCATGGATTTTGTGG - Intergenic
1071552838 10:86580467-86580489 GGGTGTGGTCATGGCCCTTCTGG + Intergenic
1074195698 10:111182873-111182895 GGGTGGGAACATGACTCTTACGG + Intergenic
1076902230 10:133345424-133345446 GTGTCTGAACATGCAGCTTCGGG + Intronic
1078073896 11:8139705-8139727 GGACTTGAACATGGATCTTTTGG - Intronic
1079417537 11:20253500-20253522 GGATTTGAAGATGGATCTCCAGG - Intergenic
1080691900 11:34565284-34565306 GGGTGTGAACTTGAATGTTGAGG - Intergenic
1081012143 11:37826855-37826877 GATTGTCAACATGGAGCTTCAGG + Intergenic
1083253838 11:61484690-61484712 GGGTGTCGAAATGGACCTTCCGG - Exonic
1086327215 11:85714465-85714487 GGGTGAGAAAATGGATTATCAGG + Exonic
1087941248 11:104100002-104100024 AGTTGTGAACATGTATTTTCTGG - Intronic
1088476181 11:110241733-110241755 TGTTATGAACATGGATATTCAGG - Intronic
1090131049 11:124142284-124142306 GGGTTTGAAGACCGATCTTCTGG + Intronic
1093811175 12:23493840-23493862 GGTTGTGAACTTGGTTCATCTGG - Intergenic
1094834614 12:34316424-34316446 GGGTGTGAACTTGGGACATCAGG + Intergenic
1094837186 12:34327641-34327663 GGGTGTGAACCTGGGACTCCAGG + Intergenic
1096110247 12:49024518-49024540 GGGTGTTGACAGGGATCCTCTGG - Intronic
1097449629 12:59720659-59720681 GGGTGTGAACATGGGAGTTGGGG - Intronic
1098460323 12:70726060-70726082 GGGTTTTAGCTTGGATCTTCTGG - Intronic
1102122218 12:110450367-110450389 GGGTGCGGACGTGGAGCTTCCGG + Exonic
1107969650 13:45629003-45629025 GGGTGTGAGCATGGATCTGAGGG + Intergenic
1108162444 13:47655968-47655990 GAGTGAGAAAATGGATCTTTGGG - Intergenic
1113070425 13:106414804-106414826 TGGTGTGAACATGCAGCCTCTGG - Intergenic
1115483040 14:33881089-33881111 TTGTCTGGACATGGATCTTCAGG + Intergenic
1117395913 14:55310429-55310451 GGGAGTGCTCATGGATCTGCAGG + Intronic
1118505349 14:66404926-66404948 GAGTGTGGACATGGATCCTGAGG + Intergenic
1125519298 15:40339300-40339322 GGGTATGAAGATGCATCTACTGG + Intronic
1126593795 15:50366023-50366045 GGGTGTGAAGAAAGATTTTCAGG + Intergenic
1128810913 15:70572042-70572064 GGATGGGGACATGGATCTTTGGG - Intergenic
1131056001 15:89375514-89375536 GGGTGAGAACAGGGCTCTCCTGG - Intergenic
1133934246 16:10255980-10256002 GGCTGTGAGCATGGAGCTTCGGG - Intergenic
1135002598 16:18789838-18789860 GGGTGCCAACTTGGATCTTCTGG - Intronic
1135430166 16:22375527-22375549 GGTTGAGAACATTGACCTTCAGG - Intronic
1136014684 16:27388513-27388535 GAGTGTTCACATGGACCTTCTGG - Intergenic
1141782376 16:86171657-86171679 GGGTGGGAACATGGGTCCTGAGG + Intergenic
1141883122 16:86872958-86872980 GGGTGTCAGCATGGGTCTTCAGG + Intergenic
1145908022 17:28526948-28526970 GGGTAGGGACAGGGATCTTCTGG - Intronic
1149628713 17:58101564-58101586 GGGCATGAACATGCAGCTTCTGG + Intergenic
1150481402 17:65514343-65514365 GGGTGTGAACATGAACGTTGTGG + Intergenic
1153287683 18:3471386-3471408 GGTTGTGCACCTGAATCTTCTGG + Intergenic
1153354176 18:4117746-4117768 GGGTGTGTACAGGGACTTTCAGG + Intronic
1156731144 18:40194598-40194620 GGGTGTGGCCCAGGATCTTCCGG + Intergenic
1157103408 18:44750473-44750495 GGGTGTTAACATGAATTTTGGGG + Intronic
1158641003 18:59203396-59203418 GGTTGTGAAAAAGGATCTTGTGG + Intergenic
1161602846 19:5195373-5195395 GGATGTGAACCTGGACCTCCTGG - Intronic
1161875097 19:6902354-6902376 GGTTGAGAACATGGACATTCTGG - Intronic
1163134119 19:15296972-15296994 GGATCTGAACAAAGATCTTCTGG - Intronic
1165827182 19:38712143-38712165 GGGTGTGCACAGGGACCCTCTGG - Intronic
1167892183 19:52549314-52549336 GGGGGTGAACAAGGATCCCCTGG - Intronic
1167912113 19:52712276-52712298 GGGGGTGAACAAGGATCCCCTGG + Intronic
927821556 2:26270320-26270342 TGGTTTGCACATGAATCTTCAGG - Intronic
930001532 2:46864934-46864956 GGGTTTCAACATGAATTTTCAGG + Intergenic
930848642 2:55934003-55934025 GGGTCTGAAAAATGATCTTCAGG - Intergenic
931796085 2:65711542-65711564 GGGTGTGCACATGGGTGTGCTGG + Intergenic
932354732 2:71059368-71059390 GGAAGTGAACATAGATCTACAGG - Intergenic
933527121 2:83455862-83455884 AGGTGTTAACATGGATAATCTGG + Intergenic
933847013 2:86334952-86334974 AGTTGTGAACTGGGATCTTCTGG + Intronic
935896204 2:107740340-107740362 TGGTATGAAGATGGAACTTCTGG + Intergenic
941415925 2:165221396-165221418 GGATGTAAACATGGAGCTCCTGG - Intergenic
942112246 2:172693906-172693928 AGGTCTGAAAATGGATCTTGAGG - Intergenic
945373426 2:209049874-209049896 GAGTGTGGACATGGAGCTTCTGG + Intergenic
948364925 2:237448623-237448645 GGGTGCAAACATGGATCTCTCGG + Intergenic
948555981 2:238811337-238811359 GTTTCTGCACATGGATCTTCAGG - Intergenic
1172208672 20:33182249-33182271 GGGTGTGATAATGGCTCTCCTGG - Intergenic
1178189432 21:30263533-30263555 GGGTGTGAACATGAACCCTGTGG - Intergenic
1179060876 21:37978158-37978180 GGGTGTGAAATTGCATCTTGTGG - Intronic
1179493865 21:41759479-41759501 GTGTGTGGACATGGAGCTGCTGG - Intronic
1181168687 22:20996426-20996448 GGGTCTGAACATGGAGGGTCAGG + Intronic
1182800760 22:33030060-33030082 GGGTTTGCACAGGGAACTTCAGG - Intronic
1183003411 22:34880201-34880223 TGGGGTGATCATGGATCTTAAGG + Intergenic
1184270165 22:43376073-43376095 GGGTCTGAACTTGGATCTCTTGG - Intergenic
1184536743 22:45092731-45092753 GGGCTTGAACATGGATTTTAAGG - Intergenic
1184555102 22:45228837-45228859 GGGGGTGAAGAGGGATCTTTCGG - Intronic
1184797977 22:46742731-46742753 GGGTGTGCACCTGCCTCTTCTGG + Intergenic
1185057599 22:48589067-48589089 GGGTCTGAAGATGGATTTTCTGG - Intronic
950128714 3:10527405-10527427 GGATTTGAACCTGGGTCTTCTGG + Intronic
952697244 3:36280781-36280803 TGGTGAGAACATGGAGCATCAGG + Intergenic
960571749 3:119191504-119191526 GGGGGTGATGATGGATATTCTGG - Intronic
960598900 3:119435544-119435566 GGGTGGGGACAGGGATCTTCAGG + Intronic
962383975 3:134918016-134918038 GGGTTTGAACCCAGATCTTCAGG + Intronic
962449354 3:135499148-135499170 GGGAGTGGAGATGGTTCTTCAGG - Intergenic
962590515 3:136885181-136885203 GGGTGAGAATATGGATATTGTGG + Intronic
964947395 3:162243052-162243074 GTGTGTACACATGGATCTTGGGG - Intergenic
968801076 4:2743604-2743626 GGGTGTGAACAGGGACCCTGGGG - Intronic
969693132 4:8717988-8718010 GGGTGAGAACATGGGTCTATAGG + Intergenic
969929846 4:10620348-10620370 TGGTGTTGACATGGATCCTCTGG - Intronic
976345030 4:83990289-83990311 GGTTGTGAAAAAGGATCTTGTGG + Intergenic
979818186 4:125136525-125136547 GGCTATGCACATGGAGCTTCAGG + Intergenic
982808925 4:159802289-159802311 GGGTGGGAATATGGATATTAAGG - Intergenic
984260700 4:177441402-177441424 GGGTCTGAAAATGACTCTTCTGG + Intronic
985984933 5:3507107-3507129 GGGTGAAAACATGTAGCTTCAGG - Intergenic
993904930 5:93612167-93612189 GGGTATGGACTTAGATCTTCTGG + Intergenic
998521781 5:142807659-142807681 GGGTGTGAACTTGAACATTCTGG - Intronic
1000104903 5:158050115-158050137 GGGTGAGCACAGGAATCTTCTGG + Intergenic
1006903566 6:37518249-37518271 GGGTGTGGACATGGGTGCTCAGG + Intergenic
1008015111 6:46509870-46509892 GGGTTTGAACATGGGTCATTTGG + Intergenic
1009770489 6:68138053-68138075 GGATGTGTCCATGGATCTACTGG + Intergenic
1011590579 6:88966612-88966634 GGTTGTGAAAAAGGATCTTATGG + Intergenic
1012691435 6:102317891-102317913 AAGTGTGAAAATGGAACTTCAGG - Intergenic
1014003220 6:116388046-116388068 AGGTGTAGACATGGATCTACTGG - Intronic
1015135179 6:129861176-129861198 GGATGTGTACATGGCTCTCCAGG - Exonic
1015700609 6:136032213-136032235 GGTAGTGAACATGTATCTTCAGG - Intronic
1016163042 6:140905844-140905866 GAGAGTGAACATGCATCTGCAGG + Intergenic
1019375846 7:691539-691561 GCGTGTGGACATGGATCCACTGG - Intronic
1022636987 7:32145368-32145390 GGGTGTGAGAATGGATGGTCTGG - Intronic
1022667008 7:32420942-32420964 AGGTGAGATCATGGATATTCAGG - Intergenic
1022805912 7:33822466-33822488 TGGTATCAGCATGGATCTTCAGG + Intergenic
1027589742 7:80102678-80102700 GGGTGTGAAGTGGCATCTTCCGG + Intergenic
1028665048 7:93332434-93332456 GGGTGTCAACATGCATTTTGAGG + Intronic
1029866490 7:103636448-103636470 AGGTGTGACCCTGGATTTTCTGG - Exonic
1034933912 7:155186094-155186116 GGGGTTGAACATGAAGCTTCTGG + Intergenic
1035758415 8:2051343-2051365 TGGTGTGCACCTGCATCTTCCGG + Intronic
1035942099 8:3912939-3912961 GGGTGTGAACATGGATTGAGAGG + Intronic
1037956296 8:23063048-23063070 GGCTGGGAACATGGATCTTAAGG - Intronic
1038357200 8:26840361-26840383 AGGTGTCAATATGGATCTCCCGG - Intronic
1040604656 8:48919980-48920002 GGGTCCGAATATGCATCTTCAGG + Exonic
1045189484 8:99868858-99868880 GGATGTGCACATGGGTCTTTGGG + Intronic
1047315974 8:123733280-123733302 GGGCTTGATCATGGGTCTTCTGG + Intronic
1048216574 8:132501065-132501087 GGATGTGAAGGTGAATCTTCAGG + Intergenic
1049122198 8:140748716-140748738 GTGTGTGAACATGTATGTTAAGG + Intronic
1050927193 9:11279217-11279239 AGGTGTGAACATGGCTCATATGG + Intergenic
1051095932 9:13465145-13465167 AAGTCTGAAAATGGATCTTCAGG + Intergenic
1052120138 9:24704545-24704567 GGGTGTGAAGTTGTATCTTATGG - Intergenic
1052343220 9:27383130-27383152 GGGTGTGAACATGGGTAGGCTGG - Intronic
1055145695 9:72932037-72932059 AGGTCTGAACAGGGATCTGCAGG - Intronic
1055393469 9:75848179-75848201 GGGTTTGAACCTGGAGCTTTTGG - Intergenic
1056374324 9:85991827-85991849 GGGGGTGATCATGGATTGTCTGG + Intronic
1062398462 9:136362191-136362213 GGGAGGCAACATGGCTCTTCAGG + Intronic
1190718963 X:53131043-53131065 GGCTTTGAAGATGGCTCTTCAGG + Intergenic
1190938341 X:55016504-55016526 GGATTTGAACATGGATAGTCTGG + Intronic
1192438315 X:71156148-71156170 TGGTGTGGACATGGATGTGCAGG - Intronic
1196507265 X:116462335-116462357 GAGTGTGAATGTGGATTTTCTGG - Intronic
1196520616 X:116667272-116667294 GGTTGTGAAAAAGGATCTTGTGG - Intergenic