ID: 919744447

View in Genome Browser
Species Human (GRCh38)
Location 1:200999906-200999928
Sequence TCTCCTCGCTGTTCTCCTGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 1, 2: 1, 3: 17, 4: 244}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919744445_919744447 -8 Left 919744445 1:200999891-200999913 CCTCGTTCTCATCCGTCTCCTCG 0: 1
1: 0
2: 0
3: 13
4: 250
Right 919744447 1:200999906-200999928 TCTCCTCGCTGTTCTCCTGTTGG 0: 1
1: 1
2: 1
3: 17
4: 244
919744443_919744447 -2 Left 919744443 1:200999885-200999907 CCTCCGCCTCGTTCTCATCCGTC 0: 1
1: 0
2: 0
3: 7
4: 255
Right 919744447 1:200999906-200999928 TCTCCTCGCTGTTCTCCTGTTGG 0: 1
1: 1
2: 1
3: 17
4: 244
919744441_919744447 6 Left 919744441 1:200999877-200999899 CCTCACCTCCTCCGCCTCGTTCT 0: 1
1: 0
2: 3
3: 121
4: 1057
Right 919744447 1:200999906-200999928 TCTCCTCGCTGTTCTCCTGTTGG 0: 1
1: 1
2: 1
3: 17
4: 244
919744440_919744447 13 Left 919744440 1:200999870-200999892 CCGTGCTCCTCACCTCCTCCGCC 0: 1
1: 0
2: 8
3: 106
4: 1035
Right 919744447 1:200999906-200999928 TCTCCTCGCTGTTCTCCTGTTGG 0: 1
1: 1
2: 1
3: 17
4: 244
919744442_919744447 1 Left 919744442 1:200999882-200999904 CCTCCTCCGCCTCGTTCTCATCC 0: 1
1: 0
2: 9
3: 421
4: 4864
Right 919744447 1:200999906-200999928 TCTCCTCGCTGTTCTCCTGTTGG 0: 1
1: 1
2: 1
3: 17
4: 244
919744439_919744447 14 Left 919744439 1:200999869-200999891 CCCGTGCTCCTCACCTCCTCCGC 0: 1
1: 0
2: 4
3: 48
4: 510
Right 919744447 1:200999906-200999928 TCTCCTCGCTGTTCTCCTGTTGG 0: 1
1: 1
2: 1
3: 17
4: 244
919744444_919744447 -5 Left 919744444 1:200999888-200999910 CCGCCTCGTTCTCATCCGTCTCC 0: 1
1: 0
2: 2
3: 131
4: 1390
Right 919744447 1:200999906-200999928 TCTCCTCGCTGTTCTCCTGTTGG 0: 1
1: 1
2: 1
3: 17
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919744447 Original CRISPR TCTCCTCGCTGTTCTCCTGT TGG Exonic
900230498 1:1554606-1554628 TGGCCTCTCGGTTCTCCTGTGGG - Intronic
900357543 1:2271973-2271995 TCTCGCAGCTGTTCTCCTCTGGG + Intronic
900506830 1:3033505-3033527 TCCCATCACTGTCCTCCTGTTGG - Intergenic
900553975 1:3270644-3270666 CCTCCTGACTGTTCTCCTCTGGG - Intronic
901988013 1:13091441-13091463 TCTCCTTGCTGCACTCCTGAGGG + Intergenic
901993799 1:13135326-13135348 TCTCCTTGCTGCACTCCTGAGGG - Intergenic
906927338 1:50132503-50132525 TCTCCTTGCTGTCCTCATGAAGG + Intronic
906968608 1:50485923-50485945 TCCCCTTGCTGTTCTCATGATGG - Intronic
909228158 1:73052348-73052370 TCTCCTCTATGTTCTCTTCTAGG - Intergenic
915252849 1:154602806-154602828 TCCCCTCTCTGTGTTCCTGTTGG - Intronic
915794478 1:158714396-158714418 TCTCCTTGGTTTTCTCCTTTTGG + Intergenic
917141785 1:171842076-171842098 TTTCCTCCCTGTCCTCCAGTCGG + Intronic
917786646 1:178466045-178466067 GCTCCTCGCTGTCCTCCAGTCGG - Exonic
918307198 1:183258102-183258124 TCTCCTCCATGGGCTCCTGTAGG - Intronic
918641233 1:186843475-186843497 TCTTCTCCCTGTATTCCTGTTGG - Intronic
919744447 1:200999906-200999928 TCTCCTCGCTGTTCTCCTGTTGG + Exonic
920263347 1:204704456-204704478 TCTCCAAGCTGTCCTCATGTGGG - Intergenic
922872127 1:228911392-228911414 TCTGCCAGCTGCTCTCCTGTGGG + Intergenic
922977720 1:229799134-229799156 TCTCCTGTCTGCTCTCCTCTTGG - Intergenic
923111270 1:230892352-230892374 TCTCCTCACTCTTCTTCTGAGGG + Intergenic
923344084 1:233034299-233034321 TCTCATGTCTGTTCTCCTGAGGG - Intronic
923771493 1:236941794-236941816 TCTCCCCTCTGCTCTCCAGTGGG + Intergenic
923993892 1:239470170-239470192 TCTCCTCTGTGTTCTCCTCTGGG - Intronic
1068352057 10:55861006-55861028 TCCCCATGTTGTTCTCCTGTTGG + Intergenic
1072225415 10:93364183-93364205 CCTCCTCGCTTTACCCCTGTTGG + Intronic
1072944176 10:99795006-99795028 CCTCCTTTCTTTTCTCCTGTGGG - Intronic
1073306340 10:102505637-102505659 TCTCCACGCTGTTGGCCTCTTGG - Intronic
1073307161 10:102512114-102512136 TCTCTTCGCTGGTCACGTGTTGG + Intronic
1074854427 10:117462718-117462740 TCTCCTCACTGATCTCCCGCTGG + Intergenic
1075522933 10:123154803-123154825 TCTCCTCGCGGTCGTCCTCTCGG + Intronic
1076180634 10:128404693-128404715 TCTCCTCTGTGTGCTCCTGATGG - Intergenic
1076468711 10:130703839-130703861 TCTTCCCGTTTTTCTCCTGTGGG + Intergenic
1076574149 10:131452931-131452953 TCCCCGTGCTGTTCTCCTGATGG - Intergenic
1076607963 10:131701613-131701635 TCTCCTCACTGGTGTCCTGATGG - Intergenic
1077908078 11:6549195-6549217 TCTCCACCTTGTTGTCCTGTTGG + Intronic
1079373798 11:19873793-19873815 TCTCATCCCACTTCTCCTGTGGG + Intronic
1079538242 11:21540714-21540736 TCCCCTGGCTGTTCTCATGATGG - Intronic
1081058158 11:38436969-38436991 GCCCCTCACTGTTCTCCTATTGG - Intergenic
1081065140 11:38532034-38532056 TCTCAGTGCTGTTCTCCTGATGG + Intergenic
1081343863 11:41958507-41958529 TCTTCTGGCTGTTCTCCTAATGG - Intergenic
1082562248 11:54632373-54632395 CCTCCTAGCTGTTCTTCTCTTGG + Intergenic
1082646501 11:55733160-55733182 CCCCCTTGCTGTTCTCCTGATGG - Intergenic
1083138132 11:60699365-60699387 TTTCTCCTCTGTTCTCCTGTGGG + Intergenic
1083741549 11:64713943-64713965 TTTCCTCTCTGTTCTCCCGCAGG - Exonic
1084535435 11:69753555-69753577 TCCCCTCCCTGTTCTCCTCCAGG - Intergenic
1084693559 11:70740715-70740737 TCTTCTGGCTGCTCTGCTGTGGG - Intronic
1085906975 11:80775215-80775237 TTTCCATGCTGTTCTCCTGTTGG + Intergenic
1090832201 11:130427722-130427744 CCTCCTCGCTGTCCTCCTGGTGG + Exonic
1092755458 12:11759009-11759031 CATCCTGGCTGTTCTGCTGTGGG - Intronic
1093858159 12:24130658-24130680 CCTCCTCTCTGTTCTCCTGAAGG - Intergenic
1093905779 12:24690549-24690571 TCTCCTGGCTATTTTCCTTTTGG - Intergenic
1094229201 12:28083514-28083536 TCCCCATGCTGTTCTCCTGATGG - Intergenic
1094327600 12:29256925-29256947 CCTCCTCCGTGGTCTCCTGTGGG + Intronic
1096002389 12:48140661-48140683 CCTCCTCCCTGTTCCCCTGCTGG + Intronic
1096865900 12:54562603-54562625 TCACCTCACTGTTCTTCTGCAGG - Intronic
1096866100 12:54564272-54564294 TCACCTCACTGTTCTTCTGCAGG + Intronic
1097503195 12:60432255-60432277 CCCCCTTGCTGTTCTCCTGAGGG + Intergenic
1098203840 12:68084995-68085017 TTTCCATGCTGTTCTCGTGTTGG - Intergenic
1103954343 12:124567905-124567927 TCCCCTCCCTCTTCTCCTGCGGG + Intergenic
1105947245 13:25200727-25200749 GCACCTCGCTTTTCTCCTGATGG - Intergenic
1107967896 13:45614001-45614023 TGTCCTCCCATTTCTCCTGTTGG - Intronic
1108513540 13:51175849-51175871 TCCCCTTGCTGTTCTCATGATGG + Intergenic
1108585949 13:51869904-51869926 TCTCCTGGTTGTGCTCATGTAGG + Intergenic
1111054612 13:82932530-82932552 TTCCCATGCTGTTCTCCTGTTGG + Intergenic
1111419863 13:87998542-87998564 CCTCCTCACTGTTCTACTGTGGG - Intergenic
1113305558 13:109074667-109074689 CCCCCACGCTGTTCTCCTGATGG - Intronic
1113585513 13:111461777-111461799 TCCCCTGGCTTTTCTCCTCTGGG - Intergenic
1116620763 14:47200700-47200722 TCTCCTTCCTCTTCTCCTGCAGG + Intronic
1118570166 14:67186954-67186976 TCTCCTAGCTCTTCACATGTGGG - Intergenic
1118730134 14:68660088-68660110 TCACCTGGCTTTGCTCCTGTGGG - Intronic
1118896196 14:69947646-69947668 CCTCCTCTCTCTTCTCCTCTTGG + Intronic
1119159282 14:72439752-72439774 CCTCCCCTCTGATCTCCTGTTGG - Intronic
1119428526 14:74551225-74551247 TCTCCACGCTGTTCTCCACTAGG + Exonic
1119668095 14:76499032-76499054 TCTAGCCGCTGCTCTCCTGTGGG - Intronic
1120535363 14:85688631-85688653 CCTCCACGCTGTTCTCGTGATGG + Intergenic
1122893340 14:104743045-104743067 CGTCCTCCCTGTTCTCATGTAGG + Exonic
1202834308 14_GL000009v2_random:66329-66351 TTTCATTGCTGTTTTCCTGTTGG + Intergenic
1127710149 15:61589157-61589179 CCCCCTTGCTGTTCTCCTGATGG - Intergenic
1128780484 15:70355755-70355777 TCTCCTCTCTTGTCTCCTCTGGG - Intergenic
1129463611 15:75712059-75712081 TCTCCTCTCCCTCCTCCTGTTGG - Intronic
1129721277 15:77879343-77879365 TCTCCTCTCCCTCCTCCTGTTGG + Intergenic
1131151341 15:90049278-90049300 CCTCCTCGCTGTACTGCTTTGGG - Intronic
1131469538 15:92684177-92684199 TCTCCTCTCTGTTCTCTTCAGGG - Intronic
1131511369 15:93051200-93051222 TCACCTCGCTGTCCTCCTCTGGG + Intronic
1133317700 16:4894567-4894589 TCTCCCCGTTGTTCTTCTGCAGG + Exonic
1133796651 16:9051854-9051876 TCTCCTCACTATTCTCCTGGGGG + Intergenic
1135483670 16:22844616-22844638 CCTCCTGGCTGTTCTCGTGATGG + Intronic
1138161992 16:54763030-54763052 TCTCCTGGGTGCTCACCTGTAGG + Intergenic
1139734148 16:68972943-68972965 CCTCCTTGCTATTCTCCAGTAGG - Intronic
1140211329 16:72972925-72972947 TCTCCTCCCTGTTCTCCTGTAGG + Intronic
1143801582 17:9387080-9387102 TCTCCTTGGTCTTCTCCTCTAGG + Intronic
1143974363 17:10819305-10819327 TCTCCTTGCTTCTCTCCTCTGGG + Intergenic
1144386903 17:14756372-14756394 TCTCCTCCTTGTTCGCCTCTTGG + Intergenic
1144387083 17:14758736-14758758 TCTCCTCCTTGTTCACCTCTTGG - Intergenic
1147577769 17:41612512-41612534 TCTCCTCTCGCTTCTCCTCTGGG - Exonic
1150237553 17:63605284-63605306 TCTACTGGCTTTTCTCCTTTAGG - Intronic
1150712842 17:67546452-67546474 CCTCTTCCCTGTGCTCCTGTAGG + Intronic
1151479342 17:74361229-74361251 TCCCCTCGCTGTTCTCGGCTTGG - Intronic
1151636511 17:75352610-75352632 TCTGATCGCTTTTCTCCTTTGGG - Intronic
1153568384 18:6443860-6443882 TTTCCTTGCTCTTCTCCTTTCGG + Intergenic
1154251138 18:12746318-12746340 GCTCCCCTCTGGTCTCCTGTGGG + Intergenic
1156040360 18:32814041-32814063 TCTCCTCGCTGGTCTGAAGTGGG + Intergenic
1156917596 18:42480102-42480124 TCTCCTACCTGCTCTGCTGTTGG + Intergenic
1157762115 18:50272889-50272911 TCTCCTCCTTGTCCTCCTCTGGG + Exonic
1160410697 18:78673679-78673701 TATCCTCACTGTTCTCCTTCTGG - Intergenic
1160562390 18:79766788-79766810 TCTCCCCATTGTTATCCTGTTGG + Intergenic
1162494956 19:11018398-11018420 ACTCGTGGCTGTTCCCCTGTGGG - Intronic
1165124078 19:33581689-33581711 TCTCCCCACAGTTCTGCTGTAGG - Intergenic
1165838745 19:38774360-38774382 TCTGCTCGCACCTCTCCTGTGGG + Intergenic
1166346329 19:42168390-42168412 TCTCCTCTCAGTCCTCCTGAAGG + Intronic
1167268868 19:48497399-48497421 TCTGCTCGCTGTTCCCCTGAGGG + Exonic
1167321677 19:48800409-48800431 TCTCCCCGGTGCTCTCCTCTTGG - Intronic
1167623426 19:50571025-50571047 TCTCCTTACTGTTCTCCGGCCGG - Intergenic
927790503 2:26005867-26005889 TCTCTTGGCTGTTTTCCTCTGGG + Intergenic
929465629 2:42141319-42141341 TCTCCTCCCTGCTCCCCTGCTGG - Intergenic
932469669 2:71945583-71945605 CCTCATGGCTGTTCTCCTGAGGG - Intergenic
932655339 2:73606472-73606494 TGTCCTGGCTGTCTTCCTGTAGG - Intronic
933455896 2:82518569-82518591 TCCCCTTGCTGTTCTCGTGATGG - Intergenic
933648357 2:84830206-84830228 TCTCCTTCCTGTTCTCCTGCAGG - Intronic
934948120 2:98556598-98556620 CCTCCTTTTTGTTCTCCTGTGGG + Intronic
937815124 2:126242980-126243002 TCTTCTCACTGTGGTCCTGTGGG - Intergenic
937904173 2:127044770-127044792 TCTCCTCGCAGTTCCCATCTAGG + Intergenic
944539415 2:200741793-200741815 TCTCCTCACTGCACTCCTGTGGG + Intergenic
946730277 2:222703056-222703078 TCTGCATGCTTTTCTCCTGTTGG - Intronic
948318812 2:237052677-237052699 TCTCCTCTCTGTTCTTCTTGTGG - Intergenic
948935195 2:241159357-241159379 CCACCATGCTGTTCTCCTGTGGG - Intronic
1169419102 20:5444911-5444933 TCTCCTTGCTGTTCTCCAGAGGG - Intergenic
1169612276 20:7395345-7395367 TCTCCTCACTGTGCTCTTCTTGG - Intergenic
1169850844 20:10049055-10049077 TATCCTTGCTCTTTTCCTGTTGG + Intronic
1170100700 20:12696231-12696253 ACTCCTCACTGCACTCCTGTCGG - Intergenic
1170268514 20:14497923-14497945 TGTCCTCTCTGTTCTCGCGTTGG - Intronic
1170644175 20:18181906-18181928 TCTGTGCCCTGTTCTCCTGTTGG + Intronic
1172833447 20:37856502-37856524 TCTCCTCGCCTTGCTCATGTTGG - Intronic
1173468923 20:43307098-43307120 TTTCCTCTCTGTTCTCTTTTAGG - Intergenic
1173929858 20:46809541-46809563 TCTCCTCCCTTGTCACCTGTGGG - Intergenic
1174149856 20:48478299-48478321 TCTCCCAGCTGCTCTCCTCTTGG + Intergenic
1175319351 20:58074450-58074472 TCTCCCCGCTGTACTCCGCTTGG - Intergenic
1175841867 20:62033126-62033148 TGGCCTCACTCTTCTCCTGTGGG - Intronic
1176169831 20:63691784-63691806 CCTCCTCGCGGTTCTTCTGCCGG - Exonic
1179605009 21:42509503-42509525 TCTCCTCACTGGGCTCCTGTAGG + Intronic
1179913219 21:44461009-44461031 TCTCCCTGCTGGTTTCCTGTTGG + Exonic
1180168764 21:46046506-46046528 TCTGATCGCGGTTCTCCTCTGGG - Intergenic
1181392039 22:22590379-22590401 TCCCCTTGCTGTTCTCGTGATGG - Intergenic
1182441441 22:30366619-30366641 TCTCTTTCCTGTTGTCCTGTGGG + Intronic
1184589944 22:45475430-45475452 TCTCCTCTCTGCCCTCCTCTGGG - Intergenic
1185234765 22:49705348-49705370 CCTCCTCGTGGTTCTCCTGGGGG - Intergenic
1185369706 22:50455419-50455441 GCTCCTCGCTGACCTCCTGGCGG - Intronic
950042583 3:9929845-9929867 TCTCCGAGCTGTTCACCTGCTGG - Exonic
950478458 3:13228909-13228931 TCTCCTCTCTTTTCTCCTCCTGG + Intergenic
951709904 3:25576869-25576891 TCTCCTCTCTTCTCTTCTGTTGG + Intronic
952619414 3:35319279-35319301 TATCATCTCTCTTCTCCTGTGGG - Intergenic
952907627 3:38152775-38152797 TCTGCTTCCTGTTCTGCTGTGGG + Intergenic
953107392 3:39897465-39897487 TATCCTCTCTGTTGTCATGTTGG + Intronic
954992140 3:54850659-54850681 CCTCCTTTGTGTTCTCCTGTCGG - Intronic
956273335 3:67471024-67471046 TCTCTTTGCAGTGCTCCTGTGGG - Intronic
959647937 3:108724211-108724233 CCCCCTTGCTGTTCTCCTGATGG + Intergenic
960334251 3:116396712-116396734 TCTACTCAGTGTTTTCCTGTGGG + Intronic
961872076 3:129995946-129995968 TCTCCTTGCAGTCCTCCTGGAGG - Intergenic
962143865 3:132819737-132819759 GCTTCTCTCTGCTCTCCTGTGGG - Intergenic
962896350 3:139718449-139718471 TCTCCTGGCTCTCCTGCTGTGGG + Intergenic
963602918 3:147392822-147392844 TGTACTAGCTGTGCTCCTGTAGG - Intronic
963760063 3:149279203-149279225 TCTTCTCTTGGTTCTCCTGTGGG - Intergenic
964400017 3:156289089-156289111 CCTACTCCCTGTTCTGCTGTTGG + Intronic
964433444 3:156628589-156628611 CCTCCTCGCTGTTCTTCAGAGGG + Intergenic
965317297 3:167208414-167208436 TCTCCTCTCTCTTCTCCTCAAGG - Intergenic
968666782 4:1826764-1826786 TCTTCTCCCTGTCCTCCTGGGGG + Intronic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
968793165 4:2683224-2683246 TCTTTTCCCTGTTCTTCTGTAGG + Intronic
970933331 4:21538971-21538993 TCTCCATGCTGTTCTCCTGACGG + Intronic
971209717 4:24604054-24604076 TCTCCATGCTGTTCTCATGATGG - Intergenic
972564568 4:40258552-40258574 TTTCCTAGCTGTTCTACTCTGGG - Intergenic
976118500 4:81754285-81754307 TCTCCTCCCTCTACTCCTGCAGG - Intronic
976907888 4:90262957-90262979 TGTCCTCGCTGAGTTCCTGTGGG + Intronic
977461256 4:97328443-97328465 TCTCCTCTCCGTTCTCCTAAGGG - Intronic
979801286 4:124912646-124912668 TCTTCTCTCTCTTCTCCTTTGGG + Intergenic
980174166 4:129324797-129324819 CCTCCTCCCGGATCTCCTGTGGG + Intergenic
980396468 4:132222368-132222390 TCCCCTTGCTGTTCTCATGATGG + Intergenic
980953527 4:139405858-139405880 TCTTATCACTGTTCTCATGTAGG - Intronic
982818493 4:159917240-159917262 TCCCCTCACTGCTCTCCTCTGGG + Intergenic
983067816 4:163231784-163231806 TCTCCTCCTTGTTCTACAGTAGG - Intergenic
984454773 4:179951526-179951548 TCTCCTCTCTCTTTTCATGTTGG + Intergenic
1202765710 4_GL000008v2_random:147221-147243 TTTCATTGCTGTTTTCCTGTTGG - Intergenic
986430707 5:7678345-7678367 TCTCCTTTCTGTTATTCTGTAGG - Intronic
987871864 5:23629627-23629649 TCTCCCCTCTGTTCTCCTAAGGG - Intergenic
988615133 5:32768068-32768090 TCTTCCCGCCCTTCTCCTGTTGG + Intronic
989576783 5:42995284-42995306 TTTTCTCGCTGTTTTTCTGTCGG + Intergenic
992494589 5:77280333-77280355 TCTCCTCCCTGTCCTCCTGCAGG + Intronic
993872315 5:93267535-93267557 GCTCCTCACTGATCTCCTGCAGG - Intergenic
994178307 5:96735870-96735892 TTTCCTCGCTGTTCTTCTCCAGG - Intronic
995436769 5:112144895-112144917 TCCCCTCCCTCTTCTCCTGCAGG - Intronic
997566156 5:134888107-134888129 TCTCCTCACAGTTCACCTTTGGG - Exonic
999344357 5:150802339-150802361 TTTCCTTACTGTTATCCTGTAGG + Intergenic
1003280881 6:4690399-4690421 TCCCCTTGCTGTTCTCGTGATGG - Intergenic
1004258318 6:14085206-14085228 TCCCCTCATTGTTCTCCTGAGGG - Intergenic
1005449890 6:25962300-25962322 TCTCCTTGCTGTCCTTCTGCAGG - Intergenic
1006717876 6:36131497-36131519 TCTCCTCCCTGCTCCCCTGACGG + Intronic
1011616698 6:89203914-89203936 CCTCCTCTCTCATCTCCTGTCGG - Intronic
1015652325 6:135477586-135477608 TCCCCTTGCTGTTCTCGTGATGG + Intronic
1017431032 6:154370841-154370863 GCTCCTTGCTGTTCTGATGTGGG - Intronic
1018629188 6:165807471-165807493 TGTCCTCACTGCTTTCCTGTGGG - Intronic
1019004650 6:168786178-168786200 TCTCCACCCTGATCTCCAGTAGG + Intergenic
1019929056 7:4211399-4211421 CCTTCTCGCCGCTCTCCTGTAGG - Intronic
1020255890 7:6503085-6503107 TCTCCTCTGTCTTCTCCTGGAGG + Exonic
1021392128 7:20105730-20105752 TGTCCTCCCTGTTCTCCTCCAGG + Intergenic
1021404816 7:20252809-20252831 TTTCCTCCATGTTCTCTTGTAGG - Intergenic
1022498707 7:30869160-30869182 TCTCCTCCATGTCCTCCTGGGGG - Intronic
1022515802 7:30974407-30974429 TGTCTTCCCTGTACTCCTGTAGG + Exonic
1023826291 7:44012146-44012168 GCTCCTGGCTGGTTTCCTGTAGG - Intergenic
1024081456 7:45859433-45859455 TCTGCTCCCTGTTCCCCTGCTGG - Intergenic
1026089868 7:67291011-67291033 GCTCCTGGCTGGTTTCCTGTAGG - Intergenic
1026746586 7:73017850-73017872 GCTCCTGGCTGGTTTCCTGTAGG + Intergenic
1026750238 7:73045993-73046015 GCTCCTGGCTGGTTTCCTGTAGG + Intergenic
1026753885 7:73074103-73074125 GCTCCTGGCTGGTTTCCTGTAGG + Intergenic
1026757536 7:73102139-73102161 GCTCCTGGCTGGTTTCCTGTAGG + Intergenic
1027032689 7:74902408-74902430 GCTCCTGGCTGGTTTCCTGTAGG + Intergenic
1027089868 7:75291347-75291369 GCTCCTGGCTGGTTTCCTGTAGG - Intergenic
1027093513 7:75319275-75319297 GCTCCTGGCTGGTTTCCTGTAGG - Intergenic
1027097156 7:75347242-75347264 GCTCCTGGCTGGTTTCCTGTAGG - Intergenic
1027119460 7:75506330-75506352 GCTCCTGGCTGGTTTCCTGTAGG - Intergenic
1027214117 7:76173274-76173296 TCTCCCCGCAGTTCTCTTGGAGG + Intergenic
1027272365 7:76529281-76529303 GCTCCTGGCTGGTTTCCTGTAGG + Intergenic
1027322192 7:77020428-77020450 GCTCCTGGCTGGTTTCCTGTAGG + Intergenic
1027325822 7:77048347-77048369 GCTCCTGGCTGGTTTCCTGTAGG + Intergenic
1028024478 7:85820795-85820817 TATCCTCTCTGTGCTCTTGTGGG + Intergenic
1028472942 7:91224279-91224301 CCTCTTCCCTGTTCTCCTGAAGG + Intergenic
1029398265 7:100324243-100324265 GCTCCTGGCTGGTTTCCTGTAGG - Intergenic
1029493193 7:100883453-100883475 TCTCCTCTCTCTCCCCCTGTGGG + Intronic
1029718036 7:102343702-102343724 GCTCCTGGCTGGTTTCCTGTAGG + Intergenic
1029754578 7:102565543-102565565 GCTCCTGGCTGGTTTCCTGTAGG - Intronic
1029772529 7:102664627-102664649 GCTCCTGGCTGGTTTCCTGTAGG - Intronic
1034737039 7:153439104-153439126 TCTCCTTACTGCTCTCTTGTGGG + Intergenic
1035287833 7:157817374-157817396 TCAGCTCCCTGTTCTCCTGCTGG - Intronic
1035551391 8:529969-529991 TCTACTCCCTTTTCTCCTTTTGG + Intronic
1035646460 8:1225411-1225433 TCTCCTCTCTGTTCTGCCGCTGG - Intergenic
1035918281 8:3649621-3649643 TCTCCGTGCTGTTCTCATGATGG - Intronic
1039846729 8:41330684-41330706 TTTCCTCACTGATTTCCTGTGGG - Intergenic
1041362205 8:57066042-57066064 ACTGCTCTCTGTTCTCCTGGAGG - Intergenic
1042382700 8:68136779-68136801 TCTCCACGCTGCCCTCCTTTGGG + Intronic
1043918854 8:85957838-85957860 TCTCCTCCATGTTCTCTTCTAGG + Intergenic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1045528767 8:102964165-102964187 TCTTCTCCCTGTTCCTCTGTAGG - Intronic
1046359320 8:113130361-113130383 CCTCCTTGCTGTTCTCATGACGG + Intronic
1046898735 8:119500968-119500990 TCTGCTGGCTGTTCTCCTGGCGG + Intergenic
1049741369 8:144242665-144242687 TCTCCTCTCGGCTCTCCTCTGGG + Intronic
1053518632 9:38754126-38754148 TCTCCTCCCAGTTTTCATGTGGG + Intergenic
1054814904 9:69465702-69465724 TCTCCACGGAGTTGTCCTGTTGG + Intronic
1054901838 9:70377369-70377391 TCTCCATGGTGTTCTCCTGATGG + Intergenic
1056846118 9:90039675-90039697 CCTCCTCACTGCTCTCCTGCTGG + Intergenic
1057384083 9:94592238-94592260 TATCCTTGCTTTTTTCCTGTGGG - Intronic
1060869268 9:127026728-127026750 TCCCCTGGCTTTTCTCCTGAGGG + Intronic
1062716941 9:138015454-138015476 TCTGCTTCCTGTTCTCCTGGTGG + Intronic
1203546458 Un_KI270743v1:132111-132133 TTTCATTGCTGTTTTCCTGTTGG - Intergenic
1186000600 X:5005230-5005252 TCCCCTTGCTGTTCTCATGATGG - Intergenic
1188158956 X:26777037-26777059 TCTCTTCTATCTTCTCCTGTTGG + Intergenic
1189728730 X:43996421-43996443 TCTCCTGGGTGTTCTTCTGAAGG - Intergenic
1190932961 X:54965331-54965353 TCTTCTCTTTGTTCTTCTGTGGG - Intronic
1191676820 X:63799563-63799585 TCTTCTGGCTTTTCTTCTGTAGG - Intergenic
1192632981 X:72791280-72791302 TCTTCTCTCTGTTTTTCTGTAGG + Intronic
1192648728 X:72929521-72929543 TCTTCTCTCTGTTTTTCTGTAGG - Intronic
1199182628 X:144876582-144876604 TTTCCTTGCTGTTCTCATGATGG - Intergenic
1199679265 X:150214301-150214323 TCTCCTCACTGGTCTCCAGGTGG + Intergenic
1199882536 X:151986029-151986051 TCTCCTCCCTTTGCTCCTGCTGG + Intergenic
1200325054 X:155229126-155229148 TCCCCTAGCTGCTGTCCTGTAGG + Intronic
1200364920 X:155652101-155652123 CCTCCTCGCTGTTCTCCTGATGG - Intronic