ID: 919744556

View in Genome Browser
Species Human (GRCh38)
Location 1:201000345-201000367
Sequence GGGCGGTCTGAGGGCTCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919744538_919744556 28 Left 919744538 1:201000294-201000316 CCTAAACACTGGTGGGCAGCAGT 0: 1
1: 0
2: 0
3: 15
4: 119
Right 919744556 1:201000345-201000367 GGGCGGTCTGAGGGCTCTCAGGG 0: 1
1: 0
2: 0
3: 10
4: 161
919744547_919744556 2 Left 919744547 1:201000320-201000342 CCTTGGGGACGGGCAGGGTCCAC 0: 1
1: 0
2: 1
3: 18
4: 175
Right 919744556 1:201000345-201000367 GGGCGGTCTGAGGGCTCTCAGGG 0: 1
1: 0
2: 0
3: 10
4: 161
919744546_919744556 5 Left 919744546 1:201000317-201000339 CCTCCTTGGGGACGGGCAGGGTC 0: 1
1: 0
2: 1
3: 15
4: 165
Right 919744556 1:201000345-201000367 GGGCGGTCTGAGGGCTCTCAGGG 0: 1
1: 0
2: 0
3: 10
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919744556 Original CRISPR GGGCGGTCTGAGGGCTCTCA GGG Intronic
900395481 1:2451612-2451634 GGGTGGGCTGGGGGCTCTCGGGG + Intronic
900438722 1:2643114-2643136 GGGCGGCCTGGGGGCTCCCGGGG - Intronic
900578646 1:3396625-3396647 GGGCTGGCTGGGGGCTCCCAGGG - Intronic
901731604 1:11284269-11284291 GGGGTGTCTGAAGGCTCTGACGG + Intronic
902662375 1:17914001-17914023 AGGCGGTCTGAGAGCTGTCAAGG - Intergenic
903398421 1:23020039-23020061 GGGAGGTCTGAGTGGTCGCAGGG - Intronic
904048682 1:27625059-27625081 GGGTAGACTGAGGGCTTTCAGGG - Intronic
907313330 1:53552295-53552317 GGGCCTTGTGAGGGCTCTCAGGG - Intronic
908122652 1:61000753-61000775 GGGCTGTCTGAGGGTTAGCAAGG - Intronic
911271963 1:95812795-95812817 AAGCAGTCTGAGGCCTCTCAAGG - Intergenic
915489227 1:156242230-156242252 GAGGAGTGTGAGGGCTCTCATGG - Exonic
916861077 1:168806237-168806259 GGGGGCTCTGAAGGCTCTCTTGG + Intergenic
919744556 1:201000345-201000367 GGGCGGTCTGAGGGCTCTCAGGG + Intronic
920161649 1:204003068-204003090 GGGTGGACTGAGGGCTCTGAAGG + Intergenic
920348519 1:205322084-205322106 GGGCGATCTGAGGGCACTAAAGG + Intergenic
922763898 1:228147939-228147961 GGGGGGTCTGGGGGCCCTCACGG - Intronic
922867089 1:228869371-228869393 GAGGGGTCTGAGGCCTCTGAGGG - Intergenic
1062910429 10:1208569-1208591 GGGCGGACTGAGGTGCCTCAGGG + Intronic
1063957552 10:11280824-11280846 GGGAGGTCCTAGGGCTCTGAAGG + Intronic
1067063624 10:43090845-43090867 GGCAGGTGTGAGGGCTCACAAGG - Intronic
1067357586 10:45544948-45544970 GGGAGGTCTGAGGGGACTGAAGG - Intronic
1068894789 10:62187443-62187465 GAGAGGCCTGAGGGCTCTGAAGG - Intronic
1071555341 10:86597315-86597337 GTGCGGTCTGAGGCCTCCCGTGG + Intergenic
1075064025 10:119277230-119277252 TGGTGGTCTGTGGGCTCTCTTGG - Intronic
1076344113 10:129768826-129768848 GGGCGGCCTGTAGGGTCTCAGGG - Intergenic
1076736667 10:132462112-132462134 GGGCGGGCTGGGGGCTCCCTGGG + Intergenic
1078546115 11:12248239-12248261 GGGAGTCTTGAGGGCTCTCACGG + Intronic
1081493681 11:43585027-43585049 GGACCATCTGAGGCCTCTCAGGG + Intronic
1081565490 11:44258453-44258475 GGGAGGTCAGAGGACACTCAGGG - Intergenic
1081664691 11:44909929-44909951 GGGTGCTCTGAGGGGTGTCAGGG + Intronic
1081769362 11:45638378-45638400 TGGCAGGCTGAGGGTTCTCATGG + Intergenic
1083332832 11:61906956-61906978 GGGCGGTCCCAGAACTCTCATGG - Intronic
1083759261 11:64806833-64806855 GGGCTGTCTGAGGGGTGTCCAGG - Intronic
1084220418 11:67674390-67674412 GGGCGGGCAGAGGGAGCTCAGGG - Intronic
1084650945 11:70488860-70488882 GGGTGGCCTGAGGGTTCTCTGGG + Intronic
1085399476 11:76227123-76227145 GGGCGGTCAAAGGCCTCTCCCGG + Intergenic
1090277063 11:125427766-125427788 GGGAGGTTTGGGGGCTCTTATGG - Intronic
1091629272 12:2147000-2147022 GGGGGGTTGGAGAGCTCTCAGGG - Intronic
1091691731 12:2601783-2601805 GGGTGGTGTGAGGGGTCTCTGGG + Intronic
1094828188 12:34287955-34287977 GGGGGGTCTGAGTCCTCCCACGG + Intergenic
1096403221 12:51324209-51324231 GGGCGGCCTGAGGTGGCTCAGGG - Intronic
1097200331 12:57272850-57272872 GAGCAATCTGAGGACTCTCAGGG + Intronic
1100432572 12:94543688-94543710 GGGCGGAGTGAGGCATCTCATGG - Intergenic
1101494202 12:105237835-105237857 GGGCTGTCTGAGCCCTTTCAAGG - Intronic
1101504247 12:105331220-105331242 GGCGGGTCTCAGGGCTCTCCTGG + Intronic
1104904169 12:132204701-132204723 GGGCTGGCTCAGGGCTCTCCAGG - Intronic
1109745463 13:66617838-66617860 CGGCAGTCTGAGGTCCCTCAGGG - Intronic
1113392047 13:109907338-109907360 GGGAGGTGTGTGGGCCCTCAGGG + Intergenic
1118921368 14:70152680-70152702 GGGGGAACTGAGGGCTCTCTTGG - Intronic
1119209030 14:72816107-72816129 GGGAAGTCTGAGGGCTCACGTGG - Intronic
1120644028 14:87050681-87050703 GGGCTGTCTGAGGTCACTCCAGG + Intergenic
1121493204 14:94374768-94374790 GGGCAGGCTGTGTGCTCTCAGGG - Intergenic
1122370109 14:101225021-101225043 GGGCGATGGGAGGGCTCACAAGG - Intergenic
1202898023 14_GL000194v1_random:21232-21254 CTGAGGTCTGAGTGCTCTCATGG - Intergenic
1125539554 15:40462075-40462097 TGGCGCTCTGAGGGCACGCACGG - Exonic
1128746963 15:70121422-70121444 GGGCAGTGTGAAGGCCCTCAGGG - Intergenic
1132586120 16:706314-706336 GGGGGGTGTGAGGGCTGTGAAGG - Intronic
1132749018 16:1448832-1448854 GGGCGGCCTCTGGGCTCCCAGGG - Intronic
1133218224 16:4306443-4306465 TGCAGGCCTGAGGGCTCTCATGG - Intergenic
1136628769 16:31477209-31477231 GGGCGGGCTGCGGGGTCCCAGGG + Intronic
1136684173 16:31984341-31984363 TGAGGGTCTGGGGGCTCTCAGGG + Intergenic
1136688077 16:32007742-32007764 GGGCAGGCTGAGGCCTCTGAAGG + Intergenic
1136784801 16:32927893-32927915 TGAGGGTCTGGGGGCTCTCAGGG + Intergenic
1136788680 16:32951297-32951319 GGGCAGGCTGAGGCCTCTGAAGG + Intergenic
1136881132 16:33902637-33902659 GGGCAGGCTGAGGCCTCTGAAGG - Intergenic
1136884982 16:33925913-33925935 TGAGGGTCTGGGGGCTCTCAGGG - Intergenic
1138078712 16:54068340-54068362 GGGCGAGCTCAGGGCTCTCAAGG - Intronic
1140953095 16:79837909-79837931 GAGTGGTCTGAAGGCTCCCATGG + Intergenic
1141111634 16:81275299-81275321 TGGGGGTCTCAGGGCTCTCCAGG - Intronic
1142289727 16:89188018-89188040 GGGTGGGCTGAGGGCCCTGAGGG + Intronic
1203087462 16_KI270728v1_random:1191899-1191921 TGAGGGTCTGGGGGCTCTCAGGG + Intergenic
1203090877 16_KI270728v1_random:1212786-1212808 GGGCAGGCTGAGGCCTCTGAAGG + Intergenic
1142909045 17:3071632-3071654 GGGTGGACTGAGGGATCCCAGGG - Intergenic
1142925517 17:3232610-3232632 GGGTGGACTGAGGGATCCCAGGG + Intergenic
1143287863 17:5804416-5804438 GGTCCTTCTGAGGGCTCTGAGGG + Intronic
1143710121 17:8728590-8728612 GGGCAGTCTGAGGGCCCTCTAGG + Intergenic
1144325796 17:14178430-14178452 GTGGGGCCTGAGGGCTCTCCCGG + Intronic
1147527589 17:41240643-41240665 GGGCAGTCTGAGACCTCACATGG + Intronic
1147748057 17:42708029-42708051 GGGCGGTCTGGGTGGTCGCAGGG + Exonic
1149570565 17:57669443-57669465 GGGAACTCTCAGGGCTCTCAGGG - Intronic
1150980208 17:70132861-70132883 GGGCATACAGAGGGCTCTCATGG - Exonic
1151570382 17:74922865-74922887 GGGTGGTCTCAGGGGCCTCAAGG + Intronic
1152321300 17:79610072-79610094 GGGCGGGCTGGGGGCGCTCCGGG - Intergenic
1152550286 17:81026382-81026404 GGGCTGACTGTGGGCTCCCATGG + Intergenic
1152593821 17:81228687-81228709 TGTCGATCTCAGGGCTCTCAGGG - Exonic
1152648785 17:81482433-81482455 AGGGGGACTGAGGGCTCCCAGGG - Intergenic
1152796327 17:82309347-82309369 AGGCGGGCAGAGGGCTCTGAGGG - Intergenic
1152862356 17:82703650-82703672 GTGGGGCCTGAGGGGTCTCAAGG - Intergenic
1158337021 18:56423391-56423413 GGGCAATCTGAGGGTTCCCAGGG + Intergenic
1160429729 18:78803253-78803275 GGGCCCTCTGAGGGATCTCAAGG - Intergenic
1160819177 19:1049839-1049861 GAGCGGTCGGGGGGCTCACAGGG - Intronic
1161670532 19:5605790-5605812 GGGCAGTCAGGGAGCTCTCAGGG - Intronic
1162533933 19:11252276-11252298 GGGAGGGCTGAGGGCCCCCAGGG + Intronic
1162567552 19:11452786-11452808 GAGCGGTGCGAGGGCTCCCAGGG + Exonic
1162808624 19:13151591-13151613 GGGCGACCTGAGGGCTCCCAGGG - Intronic
1163434725 19:17288678-17288700 GGGAGGTGTGGGGGCCCTCAAGG + Intergenic
1164622083 19:29702469-29702491 GGCCAGTCAGAGGGCTGTCATGG + Exonic
1165335998 19:35169930-35169952 GGGCTGCCTCAGGGCCCTCAAGG + Intergenic
1166093379 19:40524578-40524600 GGGAGGTCTGGGGGTTCCCAAGG - Intronic
1166299238 19:41904834-41904856 TGGCGCTCTCAGGGCTCCCATGG - Intronic
925298483 2:2793470-2793492 GAGCTGTCCGAGGGCTGTCATGG - Intergenic
926231173 2:11005339-11005361 GGGAGGTCTGACCACTCTCAGGG + Intergenic
932308438 2:70720330-70720352 GGGAGGTCTAAAGGCTCACATGG + Intronic
936008873 2:108912083-108912105 GGGTGCTCTGAGGGCTCTGGAGG + Intronic
937083653 2:119157368-119157390 TGGGGGTCTCTGGGCTCTCAAGG + Intronic
937310998 2:120903441-120903463 GGCCTGCCTGGGGGCTCTCAGGG - Intronic
938107750 2:128544816-128544838 GGGCGATCTGAGGGGTCTGCAGG + Intergenic
938370915 2:130767935-130767957 GGAAGGGCTGAGGGCTCTGAGGG - Exonic
938490273 2:131757458-131757480 CGGGGGTCTGAGTGCCCTCATGG + Intronic
938560092 2:132464626-132464648 GGGCTGTATGTGAGCTCTCAGGG + Intronic
941054108 2:160767224-160767246 GGGCGGACTGACAGCTCACATGG + Intergenic
941691373 2:168503659-168503681 GGGCTGAGTTAGGGCTCTCATGG + Intronic
941722122 2:168823419-168823441 GTGCGTTCTGAGGGCTGTGAGGG + Intronic
943370962 2:187015124-187015146 GTTCCTTCTGAGGGCTCTCATGG + Intergenic
947971448 2:234328677-234328699 CAGCGGACTGAGGGCCCTCAGGG + Intergenic
948705161 2:239786475-239786497 TGGTGCTCTGAGGGTTCTCAGGG - Intronic
948808107 2:240461597-240461619 GGCCTGTCTGAGGGCTCTGGGGG - Intronic
1170766148 20:19291331-19291353 GGCCTGTCTGAGGGCTGTGAAGG + Intronic
1172450643 20:35020350-35020372 AGGAGGGCTGAGGGCTCACAGGG - Intronic
1176232733 20:64040356-64040378 GGTCGGTTTGAGGGCCCTGAGGG + Intronic
1176265181 20:64205489-64205511 GGGGTGTCTGAGGCCTCTCGTGG + Intronic
1176796124 21:13372250-13372272 GGGTGGTTTGGGGGCGCTCAGGG - Intergenic
1177823302 21:26055522-26055544 AGGGTTTCTGAGGGCTCTCAGGG + Intronic
1180197297 21:46205415-46205437 GGGCGGGCCGAGGGCTCTGGTGG + Intronic
1182622056 22:31623714-31623736 GAGCGGTCTGAGGGCGCCGAAGG + Exonic
1184088960 22:42282622-42282644 GGGCAGCCTGAGGTCTCTGAAGG - Intronic
950180854 3:10912232-10912254 GGCAGGTTAGAGGGCTCTCAGGG - Intronic
952361851 3:32638153-32638175 GGGTCTTCTGAGGGCTCTGAGGG - Intergenic
952406743 3:33012123-33012145 GGGCTGGATGAGGTCTCTCAAGG - Intronic
953981909 3:47417559-47417581 GGGCGGTCTGTGGCCGCTCTCGG - Exonic
954214007 3:49114362-49114384 GGGGCTTCTGATGGCTCTCAGGG + Intronic
954434354 3:50488186-50488208 GGTCGGTCTGTGGGTGCTCACGG - Intronic
956081634 3:65563535-65563557 GGGTTGTTTGAGGGATCTCATGG - Intronic
960008494 3:112807034-112807056 GGGCTGTTTGAATGCTCTCATGG - Intronic
961403257 3:126662026-126662048 GGGAGCTCTGAGGTCACTCATGG + Intergenic
961645725 3:128391818-128391840 GGGTGCTCTGAGGGCAATCATGG + Intronic
961812988 3:129532433-129532455 GGGCGGCCTCACGGCTCTGAGGG + Intronic
962410928 3:135141369-135141391 TGGCAGACTGAGGGCTCCCAAGG + Intronic
965701330 3:171461091-171461113 GGGAGATCTGAGCGCTCTCTTGG + Intergenic
974973925 4:68866402-68866424 GGGCAATAGGAGGGCTCTCAAGG - Intergenic
989863349 5:46412807-46412829 GAGCGATATGAGGGCTATCACGG + Intergenic
995309357 5:110693060-110693082 GGGCGGTCTGACACCTCACATGG + Intronic
995338555 5:111030473-111030495 GGGCGGTCTGACACCTCACACGG + Intergenic
997645027 5:135476405-135476427 GGGCCGTCTGATGGCTCTGAAGG + Intergenic
998780542 5:145651512-145651534 GGGCAGACTGACAGCTCTCACGG + Intronic
1000827432 5:166062804-166062826 GTGGGGTCTGAGGTGTCTCATGG + Intergenic
1009322823 6:62312773-62312795 GGGCGGTCTGACACCTCACATGG + Intergenic
1015244747 6:131063261-131063283 GGGCCGTCAGAGGACTCTGAGGG + Exonic
1019255016 7:44044-44066 GGGTGGTCTGAGGGCTGTGCTGG - Intergenic
1020928914 7:14368841-14368863 TGATGGTCTGAGGGCTCTCCCGG - Intronic
1025006994 7:55363057-55363079 GGGCTGTCTGCGGGGCCTCAGGG + Intergenic
1028228336 7:88275577-88275599 AGGCTATCTGTGGGCTCTCATGG + Intergenic
1029203058 7:98851881-98851903 GAGCGGTCTGATGGCACACATGG + Intronic
1035381911 7:158445878-158445900 GGGTGGTCTGAGGGCTGACCCGG - Intronic
1040298549 8:46175962-46175984 GGGCGGGCTGCAGGCACTCAGGG + Intergenic
1043547931 8:81336093-81336115 GCGCCTTCTGAGGGCTCTGAGGG + Intergenic
1045299532 8:100899356-100899378 GAGAGGACTGAGGGATCTCATGG + Intergenic
1049358858 8:142202342-142202364 CGGCGGCTGGAGGGCTCTCAGGG - Intergenic
1050285669 9:4099289-4099311 TGTGGGTCTGAGGGCTCTGAAGG + Intronic
1053208160 9:36205492-36205514 GGGAGTTCTCAGGGCTCGCAGGG - Intronic
1053447544 9:38164588-38164610 GGGCAGCCTGAGCGCTCTGAAGG - Intergenic
1057606397 9:96500839-96500861 GTGTGGCCTGAGGGCTCTCCTGG - Exonic
1059418809 9:114178487-114178509 GAGTGGACTTAGGGCTCTCAAGG + Intronic
1060491939 9:124091543-124091565 GGGGGGTCTGAGGTTTCTGATGG + Intergenic
1060778205 9:126392233-126392255 GAGTGGCCTGAGTGCTCTCAGGG - Intronic
1061756218 9:132814316-132814338 GGGAGGTCTGTGGCCTCTCCTGG + Intronic
1189026288 X:37398237-37398259 GGGCGGACTGACGCCTCACACGG + Intronic
1189385259 X:40531711-40531733 AGGGCGTCTGAGGCCTCTCAGGG - Intergenic
1190599124 X:52071255-52071277 GGGCGATCAGAGGGCTCACCTGG + Intergenic
1190609700 X:52182818-52182840 GGGCGATCAGAGGGCTCACCTGG - Intergenic
1200323833 X:155216847-155216869 GGGCGGCCTGAGGGACCTCCGGG + Intronic
1201151092 Y:11096059-11096081 CTGAGGTCTGAGTGCTCTCATGG - Intergenic