ID: 919745532

View in Genome Browser
Species Human (GRCh38)
Location 1:201006194-201006216
Sequence GCCCACCCGCTGCCAAGCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 131}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919745532_919745537 16 Left 919745532 1:201006194-201006216 CCTATGCTTGGCAGCGGGTGGGC 0: 1
1: 0
2: 1
3: 16
4: 131
Right 919745537 1:201006233-201006255 TGTGGCCTAGTGTCCTGGAGAGG 0: 1
1: 0
2: 4
3: 13
4: 209
919745532_919745534 -2 Left 919745532 1:201006194-201006216 CCTATGCTTGGCAGCGGGTGGGC 0: 1
1: 0
2: 1
3: 16
4: 131
Right 919745534 1:201006215-201006237 GCATGGAGAGCACGCCACTGTGG No data
919745532_919745535 11 Left 919745532 1:201006194-201006216 CCTATGCTTGGCAGCGGGTGGGC 0: 1
1: 0
2: 1
3: 16
4: 131
Right 919745535 1:201006228-201006250 GCCACTGTGGCCTAGTGTCCTGG 0: 1
1: 0
2: 1
3: 18
4: 160
919745532_919745540 22 Left 919745532 1:201006194-201006216 CCTATGCTTGGCAGCGGGTGGGC 0: 1
1: 0
2: 1
3: 16
4: 131
Right 919745540 1:201006239-201006261 CTAGTGTCCTGGAGAGGGCCTGG 0: 1
1: 0
2: 0
3: 19
4: 232
919745532_919745538 17 Left 919745532 1:201006194-201006216 CCTATGCTTGGCAGCGGGTGGGC 0: 1
1: 0
2: 1
3: 16
4: 131
Right 919745538 1:201006234-201006256 GTGGCCTAGTGTCCTGGAGAGGG 0: 1
1: 0
2: 2
3: 11
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919745532 Original CRISPR GCCCACCCGCTGCCAAGCAT AGG (reversed) Intronic
900168113 1:1252719-1252741 GCCCACCCGCAGCCATCCAGAGG + Intergenic
900714092 1:4133104-4133126 GCCCAGTGGCTGCCCAGCATGGG + Intergenic
902932460 1:19741055-19741077 GCCCACCCCCTGCCAATGAGTGG + Intronic
903575648 1:24338068-24338090 GGCAACCCACTGCCAAGCAGCGG + Exonic
905536067 1:38722795-38722817 GCCCATCCGGGGACAAGCATTGG - Intergenic
907829888 1:58054887-58054909 GACAACCCGCTGTCAAGCAATGG + Intronic
908723350 1:67149090-67149112 GCCCACTCACTCCCAATCATAGG + Intronic
912174784 1:107141552-107141574 CCCCACCCGCTGCGATGCACAGG + Intronic
912208433 1:107533265-107533287 GCTCACTCTCTGCCCAGCATTGG - Intergenic
915278489 1:154806253-154806275 CCCCACCTGCTGCCAAGAACAGG + Intronic
919745532 1:201006194-201006216 GCCCACCCGCTGCCAAGCATAGG - Intronic
920376334 1:205510342-205510364 GCCCACCTGCTTCCAGGCAGTGG - Intronic
922762823 1:228143003-228143025 GCCCAGCTGCTGCCAGGCAGGGG - Intronic
923012196 1:230096643-230096665 GCCCCCAGGCTGCCAAGGATGGG - Intronic
924646937 1:245886863-245886885 GCAAACCCTCTGCCCAGCATAGG + Intronic
1070642105 10:78177653-78177675 GCCCGCCCACAGCCCAGCATGGG + Intergenic
1074711349 10:116180633-116180655 ACCCACCCACGGCCAATCATTGG + Intronic
1075100601 10:119503566-119503588 GCCCACACGCTGCCCAGCGCAGG - Intronic
1076224028 10:128758946-128758968 GCCCAACCACTGCAGAGCATGGG - Intergenic
1076381432 10:130026969-130026991 GCCCACCTGCTGCCAGGCCCTGG + Intergenic
1077169589 11:1160271-1160293 GCCCCCACGCTGCCACGCTTGGG - Intronic
1077987866 11:7373499-7373521 GTTCCCCTGCTGCCAAGCATAGG + Intronic
1083189190 11:61037021-61037043 GCTCACCCGGTGCCAAGCTTGGG - Intergenic
1083214670 11:61210882-61210904 GCCTACTCTCTGCCAGGCATGGG - Intronic
1083217554 11:61229711-61229733 GCCTACTCTCTGCCAGGCATGGG - Intronic
1083220548 11:61249461-61249483 GCCTACCCTCTGCCAGGCATGGG - Intronic
1083488008 11:62995664-62995686 GCCCACACCCTGCCAAGGAAGGG - Intronic
1083812007 11:65111588-65111610 GCGCAGCCGCTGCCATGCACCGG + Exonic
1085328786 11:75629374-75629396 CACCACCCCCTGCCAAGCCTGGG + Intronic
1087773926 11:102240668-102240690 ACCCACCACATGCCAAGCATTGG + Intergenic
1095986631 12:48003737-48003759 GCCCACCAGCCACCAAGCCTTGG + Intronic
1096978935 12:55717373-55717395 TCCCACCCTCTGGCAAGCCTGGG + Intronic
1097140703 12:56900483-56900505 GCCCACCATATGCCAAGCAAGGG - Intergenic
1103700444 12:122846402-122846424 GCCCAGCCCCAGCCAGGCATGGG - Intronic
1104895814 12:132163124-132163146 GCTCACCAGCAGCCAAGCACCGG - Intergenic
1106022774 13:25930800-25930822 GCCACCCAGCTGCCATGCATGGG + Intronic
1107435634 13:40378290-40378312 GCCCCCCCGCCGCCTAGCATTGG - Intergenic
1113104281 13:106756466-106756488 GTCCACAAGCTGCCAAGCAGGGG - Intergenic
1117902647 14:60551099-60551121 GCACACCCTCTCCCAAGCAGGGG - Intergenic
1118155562 14:63237966-63237988 GTCCTTCAGCTGCCAAGCATTGG + Intronic
1122925827 14:104899349-104899371 CCCCTCCCGCTGCAAAGCTTGGG + Intergenic
1125492099 15:40155873-40155895 GCCCTCCCACACCCAAGCATGGG - Intergenic
1125756676 15:42069829-42069851 GCCCCCCGGCTGCCCAGCAGAGG - Intronic
1129181699 15:73881947-73881969 GCCCATCAACTGCCAGGCATGGG + Intronic
1129727764 15:77910278-77910300 TCCCACCCCCCACCAAGCATGGG + Intergenic
1129840113 15:78738582-78738604 TCCCACCCCCCACCAAGCATGGG - Intergenic
1130271876 15:82455958-82455980 TCCCACCCCCGACCAAGCATGGG + Intergenic
1130282541 15:82531225-82531247 TCCCACCCTCCACCAAGCATGGG - Intergenic
1130314621 15:82784600-82784622 ACCCTTCCACTGCCAAGCATAGG - Intronic
1130464226 15:84183345-84183367 TCCCACCCCCGACCAAGCATGGG + Intergenic
1130488460 15:84411474-84411496 TCCCACCCCCGACCAAGCATGGG - Intergenic
1130500040 15:84490190-84490212 TCCCACCCCCGACCAAGCATGGG - Intergenic
1130586524 15:85187980-85188002 TCCCACCCCCGACCAAGCATGGG + Intergenic
1131189414 15:90301643-90301665 TCCCACCCCCTGCCAAGAATGGG - Intronic
1132185213 15:99797646-99797668 TCCCACCCCCCACCAAGCATGGG - Intergenic
1132431775 15:101766909-101766931 TCCCACCCCCCACCAAGCATGGG + Intergenic
1134517202 16:14896810-14896832 GCCCACCAAGTGCCAAGCATTGG - Intronic
1134704870 16:16295464-16295486 GCCCACCAAGTGCCAAGCATTGG - Intergenic
1134962672 16:18416650-18416672 GCCCACCAAGTGCCAAGCATTGG + Intergenic
1134966968 16:18499249-18499271 GCCCACCAAGTGCCAAGCATTGG + Intronic
1143275933 17:5710791-5710813 CCCAAACCTCTGCCAAGCATGGG - Intergenic
1145884395 17:28372152-28372174 GGCCACCCGCAGCCCACCATGGG - Exonic
1147686008 17:42287408-42287430 GCCAACCCGCTGCCAGGCAGAGG + Intergenic
1148245089 17:46025211-46025233 GTCCACCCGTTTCCAAGCCTGGG + Exonic
1148494644 17:48046025-48046047 GCCCACACCCTGCCAGGCCTAGG + Intergenic
1149775415 17:59353292-59353314 ACCCACCCGCTGCCAAACCACGG + Exonic
1149896063 17:60429424-60429446 GCCCAAGCTCTGCCATGCATGGG + Exonic
1152359780 17:79826519-79826541 CCCCACCCCCTGCCATGCACAGG + Intergenic
1152771462 17:82172214-82172236 GCCCACCCACAGCCACTCATGGG + Intronic
1160710109 19:547490-547512 GCCCACCCCCTGCAGAGAATGGG - Intronic
1160723544 19:607866-607888 GCCCACCCTCTGCCAAGCACTGG - Intronic
1161557925 19:4955027-4955049 TCCCACCCCCTCCCAAGCCTTGG + Intronic
1161668084 19:5589177-5589199 GCCCAGCCGCTGCTCACCATGGG + Intronic
1163122688 19:15227513-15227535 GCCCACATCCTGCCAGGCATAGG - Exonic
1164527374 19:29022140-29022162 GCACACCCGCGGCCCAGCACAGG - Intergenic
929218032 2:39436831-39436853 CCCGACCCGCAGCCAAGCCTGGG - Intronic
929576737 2:43056978-43057000 CCCCACACCCTGCCAAGCCTTGG + Intergenic
930166321 2:48207001-48207023 GCCCATTCACTGCCAAGCTTTGG + Intergenic
934860055 2:97757262-97757284 GCAAACACGCTGGCAAGCATCGG - Exonic
940976547 2:159952220-159952242 TCCCACACGTTGTCAAGCATTGG + Intronic
946290121 2:218738222-218738244 CCCCAGCCGCTGCCAAGCAGAGG - Exonic
946977955 2:225174389-225174411 GCCCTCCAGCTGCAAAGCCTGGG - Intergenic
1168972508 20:1940270-1940292 GCCTACCCAGTGCCAAGCGTGGG - Intronic
1170092809 20:12609893-12609915 GCCCACAGGATGCCAAGCACTGG + Intergenic
1170481276 20:16767487-16767509 GCCCACCCAGTGCCAAGAAAAGG - Intronic
1176429712 21:6568181-6568203 GCCCACCCACTGCTAGGCCTGGG + Intergenic
1176905432 21:14494544-14494566 CCCCACCCCCTGACAAGCAGTGG - Intronic
1179265788 21:39801982-39802004 GTCCATCCTCTGCAAAGCATAGG - Exonic
1179705106 21:43175643-43175665 GCCCACCCACTGCTAGGCCTGGG + Intergenic
1179980096 21:44891256-44891278 GCACACCCCCTGCCAGGCGTGGG - Intronic
1180163108 21:46006808-46006830 TCCCAGCCCCTGCCAGGCATGGG - Intergenic
1180799268 22:18624232-18624254 ACCCAGCTGCTGCCATGCATTGG - Intergenic
1180865318 22:19115315-19115337 GCTCACCAGCTGCCCAGCCTGGG - Intronic
1181222450 22:21371034-21371056 ACCCAGCTGCTGCCATGCATTGG + Intergenic
1181638206 22:24184020-24184042 ACCCAGCTGCTGCCATGCATTGG + Intronic
1181876631 22:25945610-25945632 GCCCAGCCCCTCCCAGGCATGGG - Intronic
1182123578 22:27801311-27801333 GCGCACCCGCTGCCGAGCAGAGG - Exonic
1183530507 22:38351023-38351045 TCCCACCCTCTGCCAAAGATGGG + Intronic
1184466902 22:44673810-44673832 GCCCACCCTCTCCCAGCCATAGG - Intronic
1184837047 22:47029919-47029941 TCCCACCCTCTGCCCACCATTGG + Intronic
949970190 3:9397493-9397515 GCCCACTCGCCGCCAATCAGCGG - Intergenic
950640682 3:14346290-14346312 GCCCAGCCCCTGCAAAGCCTGGG - Intergenic
951479537 3:23144857-23144879 CCCCACCCCCTGACAAGCCTTGG - Intergenic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
954123067 3:48511712-48511734 GCCCACCATGTGCCAAGCAGTGG - Intergenic
954393238 3:50278547-50278569 GTCCACCCACTGGCCAGCATGGG + Intergenic
956962842 3:74422886-74422908 GTCCACCAGCTGACAAGCACTGG - Intronic
960994537 3:123332275-123332297 CACCACCCGCTTCCAAGGATGGG + Intronic
964402748 3:156316242-156316264 ACCCACCCCCAGCCAAGCAGTGG + Intronic
968390562 4:188789-188811 GCCCAGCCCCAGCCAAGAATAGG - Intergenic
968680197 4:1913404-1913426 GCCCACCCGCAGCCATCCAGAGG + Intronic
968682785 4:1932995-1933017 GCTCAGGCACTGCCAAGCATAGG - Intronic
972339275 4:38137051-38137073 GCCCACACGCTGTCCAGCCTTGG - Intronic
982382421 4:154763387-154763409 GCCCTCCTGCTGCCAAACTTTGG + Intergenic
984121080 4:175745475-175745497 GCCCACCATGTGCCAAGCATTGG + Intronic
986335213 5:6749636-6749658 GCCCACCCGTCGCCAGGCATGGG + Exonic
988754977 5:34238253-34238275 GCCCACTAGCTACCAAGCAATGG + Intergenic
990872402 5:60446837-60446859 GCCTGCCCCCTGCCAAGCTTTGG + Intronic
991743189 5:69703937-69703959 GCCCACTAGCTACCAAGCAATGG + Intergenic
991754506 5:69851266-69851288 GCCCACTAGCTACCAAGCAATGG - Intergenic
991794762 5:70283673-70283695 GCCCACTAGCTACCAAGCAATGG + Intergenic
991804125 5:70408016-70408038 GCCCACTAGCTACCAAGCAATGG - Intergenic
991822577 5:70579248-70579270 GCCCACTAGCTACCAAGCAATGG + Intergenic
991833835 5:70726414-70726436 GCCCACTAGCTACCAAGCAATGG - Intergenic
991887140 5:71283211-71283233 GCCCACTAGCTACCAAGCAATGG + Intergenic
992456598 5:76922162-76922184 CTCCACCCCCTCCCAAGCATAGG + Intergenic
997233382 5:132258937-132258959 GCCCACCCCCTCCCAAGAACTGG - Intronic
1004753389 6:18586227-18586249 GTTCACCCGCTGCCAAGACTTGG + Intergenic
1005553598 6:26949964-26949986 GCCCACTAGCTACCAAGCAATGG + Intergenic
1008135018 6:47764936-47764958 GCCCACCCTCTCCCCACCATTGG + Intergenic
1010204558 6:73310467-73310489 GCTCACCGGCTGCCAAGTAGAGG + Intergenic
1011753401 6:90475729-90475751 CCCCACCCTCTGCCCAGCATAGG + Intergenic
1013175757 6:107675270-107675292 GCCCAGCCCCTGCCAAGCCACGG - Intergenic
1015997791 6:139012914-139012936 GCCCACTCCCTGTCAGGCATGGG + Intergenic
1023880220 7:44313994-44314016 GCCCACCCTGAGCCAGGCATTGG + Intronic
1026017335 7:66681855-66681877 GCCCTCCCGCTGCTGCGCATCGG + Intronic
1032059785 7:128714987-128715009 GCCCACATGCTGCAAAGCTTAGG + Intronic
1035288253 7:157819752-157819774 GCCCACCCACTGCCAGCCATGGG + Intronic
1035634145 8:1130879-1130901 GCCCAGCCGCTGCCGAGCTAGGG - Intergenic
1049705322 8:144039539-144039561 GCCCACCCCTTGCCCAGCAGAGG - Intronic
1051335303 9:16060472-16060494 GCCCGCTTGCTGCCAAGCAGGGG + Intronic
1059234423 9:112750430-112750452 GCCCACCAGCAGCCACGCTTGGG - Intergenic
1061061994 9:128255130-128255152 TCCCACCCCCTACCAAGCATGGG + Exonic
1062210944 9:135363695-135363717 GCCCACAGCCTGCCAGGCATGGG + Intergenic
1062677552 9:137756231-137756253 GCACACCCACTGCCAAGAAGGGG - Intronic
1192758665 X:74072155-74072177 CCCCACCCGCTGACAAGCCCTGG + Intergenic
1201935407 Y:19406552-19406574 GCCCACCCATGGCCAACCATGGG - Intergenic
1202370989 Y:24195293-24195315 TCCCACCCCCCACCAAGCATGGG - Intergenic
1202499795 Y:25474824-25474846 TCCCACCCCCCACCAAGCATGGG + Intergenic