ID: 919745983

View in Genome Browser
Species Human (GRCh38)
Location 1:201009453-201009475
Sequence CTGTCGAAGGAGAAGATTGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 153}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919745983_919745995 16 Left 919745983 1:201009453-201009475 CCCTCAATCTTCTCCTTCGACAG 0: 1
1: 0
2: 0
3: 6
4: 153
Right 919745995 1:201009492-201009514 CCCATGATGGAGAGAGCCCTGGG 0: 1
1: 0
2: 1
3: 16
4: 195
919745983_919745993 15 Left 919745983 1:201009453-201009475 CCCTCAATCTTCTCCTTCGACAG 0: 1
1: 0
2: 0
3: 6
4: 153
Right 919745993 1:201009491-201009513 GCCCATGATGGAGAGAGCCCTGG 0: 1
1: 0
2: 0
3: 25
4: 238
919745983_919745990 3 Left 919745983 1:201009453-201009475 CCCTCAATCTTCTCCTTCGACAG 0: 1
1: 0
2: 0
3: 6
4: 153
Right 919745990 1:201009479-201009501 GGGCCGGATCCTGCCCATGATGG 0: 1
1: 0
2: 1
3: 14
4: 148
919745983_919745997 21 Left 919745983 1:201009453-201009475 CCCTCAATCTTCTCCTTCGACAG 0: 1
1: 0
2: 0
3: 6
4: 153
Right 919745997 1:201009497-201009519 GATGGAGAGAGCCCTGGGTCAGG 0: 1
1: 0
2: 3
3: 38
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919745983 Original CRISPR CTGTCGAAGGAGAAGATTGA GGG (reversed) Exonic
900945875 1:5831105-5831127 CTGTGGAGGAAGAAGACTGATGG - Intergenic
902691983 1:18115698-18115720 CTCTCCAAGGAGAACATAGAGGG - Intronic
902696520 1:18144200-18144222 CTGGGGAAGGAGAAGATGGGAGG - Intronic
904051226 1:27640216-27640238 CTGTGGAAGGAAAAGCTGGATGG - Intergenic
904203230 1:28835401-28835423 ATGTCATAGGAGAAGATTAAAGG - Intronic
905580480 1:39080556-39080578 CTGTCCTAGGAGAGGATAGAAGG + Intergenic
909543904 1:76822596-76822618 CTGGCGAGGCAGAAGATTGGAGG - Intergenic
910122760 1:83808682-83808704 CTGGCTAAGGAGAGGAGTGAGGG + Intergenic
910609118 1:89121271-89121293 CTGTAGAAGGAGAGGATAAAAGG + Intronic
911141405 1:94506708-94506730 CTGTCCAAAGAGAAGATTCCAGG + Intronic
914956767 1:152169648-152169670 CTGTCCCAGGAGAAGAGGGAAGG + Intergenic
915790902 1:158669882-158669904 ATGTGGGAGGAGAAGTTTGAAGG + Intronic
919745983 1:201009453-201009475 CTGTCGAAGGAGAAGATTGAGGG - Exonic
921066100 1:211622950-211622972 CTGTAGAAAAAAAAGATTGATGG + Intergenic
922013877 1:221622912-221622934 CTGTTGAAAGAGAAGATGGGAGG + Intergenic
1062764468 10:50138-50160 CTGGAGAAGGAGAAAATTGCTGG + Intergenic
1063224662 10:4004486-4004508 CTGTTGAATGAGAAGGCTGAAGG + Intergenic
1065050324 10:21785423-21785445 CTGTGGAAGAAGAAAACTGAAGG + Intronic
1070584021 10:77747602-77747624 CTTTCAAAGGAGAAGATAAATGG - Intergenic
1071399658 10:85256891-85256913 CTGGCAAAGGAGGAGATGGAAGG - Intergenic
1073545749 10:104347371-104347393 CTGGAAAAGGAGAAGATTAAAGG + Intergenic
1074638252 10:115345635-115345657 CTGTTGGAGGGGACGATTGATGG + Intronic
1079903850 11:26221499-26221521 CTGTAGAAAGAGCAGATTGATGG + Intergenic
1085343021 11:75745863-75745885 TTGTCGATGGAGATGATTGCAGG + Intergenic
1085467877 11:76736550-76736572 CTGCCTAAGGAGAGGATTTAGGG + Intergenic
1085913996 11:80862872-80862894 ATGTAGAAGGAGAAGAGTCAGGG - Intergenic
1087128729 11:94651100-94651122 CTGTCTAAGGACAAGATAGAGGG + Intergenic
1089187087 11:116625442-116625464 CTGTGGAAGGATAAGGTGGAAGG + Intergenic
1091408173 12:221679-221701 GTGTGGATGGAGAAGATTGGAGG - Intronic
1094814260 12:34167847-34167869 CTGGAGAAGGAGAAAATTGTTGG + Intergenic
1095102664 12:38200743-38200765 CTGGAGAAGGAGAAAATTGCTGG - Intergenic
1095199804 12:39370226-39370248 CTTGCCAAAGAGAAGATTGAAGG - Exonic
1099281857 12:80660005-80660027 CTTTCTAAGGTGAAGATTGTAGG - Intronic
1102787163 12:115614386-115614408 GTGTCCAAGGAGTAGATGGAAGG + Intergenic
1103200508 12:119084191-119084213 CTGTAGAAGGTGAATATTGGAGG + Intronic
1103532488 12:121612047-121612069 CTGTGAAAGGGGAATATTGATGG - Intergenic
1110833322 13:80056521-80056543 CTGTAAAGGGAGAAAATTGATGG + Intergenic
1111308469 13:86448243-86448265 CTGTCTGAGGAGGAGATAGAGGG - Intergenic
1111729189 13:92051851-92051873 ATGTGGAAAGAGAACATTGATGG + Intronic
1112447089 13:99474028-99474050 ATGGCAAAGCAGAAGATTGATGG + Intergenic
1121978166 14:98425691-98425713 CTGTTGCAGGAGAAGAATGAAGG - Intergenic
1122584738 14:102797517-102797539 CAGTGGAAGGACAAGATTGCAGG + Intronic
1127774724 15:62255833-62255855 CTGTCAAAGCAGCAGGTTGAAGG + Intergenic
1128160521 15:65420746-65420768 CTGTAGAAGGAGAATGATGATGG - Intronic
1129067149 15:72914802-72914824 CTGTGGAAGGAGAAGGCAGAAGG - Intergenic
1131343928 15:91628598-91628620 CTCTCCAAGGAGAGGATTCAAGG + Intergenic
1133019978 16:2963127-2963149 GTGTCGATGGAGAAGAAAGATGG - Intergenic
1134132776 16:11660885-11660907 CATTCGAGGGAGAAGATCGAAGG - Intergenic
1135923372 16:26671099-26671121 CTGTTGAAGCACAATATTGAAGG - Intergenic
1136099751 16:27985234-27985256 CTGTTGAAGGTGGGGATTGATGG + Intronic
1136144951 16:28311078-28311100 GTGTGGAAGGAGAAGAAGGAGGG + Intronic
1140700946 16:77581077-77581099 CTGTCCAAGGAGAAGATGGCTGG + Intergenic
1142440183 16:90093107-90093129 CTGGAGAAGGAGAAAATTGCTGG - Intergenic
1144212225 17:13025429-13025451 CTGTCCAGGGAGAAGGGTGAGGG + Intergenic
1145989496 17:29070419-29070441 ATGTCCTAGGAGAAGATGGAAGG + Intergenic
1147000133 17:37356233-37356255 CTGTTAAAGTAGAAGATTAATGG + Intronic
1147388394 17:40095121-40095143 CTGGGGGAGGAAAAGATTGAAGG + Intronic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1152957368 18:50454-50476 CTGGAGAAGGAGAAAATTGCTGG + Intronic
1155068942 18:22296107-22296129 CTGTAGAAGGAGCAGATTTCTGG - Intergenic
1156038129 18:32789015-32789037 CATTCTAAGCAGAAGATTGAAGG - Intergenic
1157284037 18:46364993-46365015 CTGTGACAGGAGAAGAGTGAGGG + Intronic
1164979520 19:32603308-32603330 CTGTCCATGGAGTGGATTGATGG + Intronic
1165007716 19:32820073-32820095 CTATCGAAGGAGAAGAGGGTGGG + Intronic
1165902183 19:39174127-39174149 CTGGGGAGGGAGAAGAGTGAGGG - Intronic
1166147201 19:40845896-40845918 CAGTCGAAGGGGAATTTTGAGGG + Intronic
1166151358 19:40877792-40877814 CAGTCGAAGGGGAATTTTGAGGG + Intronic
1167294149 19:48639668-48639690 CTGGGGGAGGAGAAGGTTGAGGG - Intronic
930066576 2:47332436-47332458 CTGTGGGAAGGGAAGATTGACGG - Intergenic
931178865 2:59879978-59880000 TTGTCGAAGGAGATGAAAGATGG - Intergenic
943002747 2:182349546-182349568 CTTTCTAATCAGAAGATTGATGG - Intronic
943882282 2:193160965-193160987 CTGTCAAGTCAGAAGATTGAGGG + Intergenic
945126369 2:206515527-206515549 CTGTAGGAGCAGAAGATTAAAGG - Intronic
945150823 2:206789040-206789062 CTTTCTAAGGAGTACATTGATGG - Intronic
945281461 2:208039423-208039445 ATGTGGAAGAAAAAGATTGAGGG - Intergenic
945924255 2:215787753-215787775 CTGGCCACGGAGAAGATGGACGG + Intergenic
947158596 2:227188944-227188966 CTGCCGAAGGAGCATATAGAAGG + Intronic
948933991 2:241150526-241150548 CAGTCGCAGGAGATGATGGAGGG + Exonic
1169883752 20:10375353-10375375 ATGTGGAAGAAGAAGATTTATGG - Intergenic
1171296971 20:24025907-24025929 CTGCCCACGGAGATGATTGAAGG + Intergenic
1171775454 20:29363223-29363245 CTGGAGAAGGAGAAAATTGCTGG + Intergenic
1173114555 20:40228381-40228403 CTGCCCATGGAGAAGACTGAGGG - Intergenic
1174726486 20:52868106-52868128 CTGTGGAAGGACAAAATGGAAGG - Intergenic
1176662754 21:9655063-9655085 GTGGTGAAGGAGAAGATTGTTGG - Intergenic
1178194978 21:30334350-30334372 CTGTAGAGGGATAGGATTGACGG - Intergenic
1178803800 21:35821665-35821687 CTTTGGAAGGTGAAGACTGAAGG + Intronic
1181780706 22:25190896-25190918 CTGTGTAAGGGGAAGAATGAGGG + Intronic
1181861631 22:25823592-25823614 CTGTCGAAGGTGGTGCTTGAAGG - Exonic
1182155934 22:28072974-28072996 CTGATGGAGGAGAAGATAGAAGG + Intronic
1184103997 22:42356999-42357021 CTGAGGAAGGAGAAGCTTAAGGG + Intergenic
958735420 3:98003737-98003759 CTGTCGTAGGACAAGATGCATGG - Intronic
958735755 3:98007628-98007650 CTGTAAAAGGAGAGGAATGATGG + Intronic
958735853 3:98008740-98008762 CTGTTAAAGGAGAAGGTTCAGGG - Intronic
963219194 3:142788223-142788245 CTGTGGCAGGAGTAGATGGAGGG + Intronic
969415176 4:7053230-7053252 CGGCAGAAGGAAAAGATTGAGGG + Intronic
970969202 4:21961855-21961877 GTGTGGAAGCAGAACATTGATGG + Intergenic
971546621 4:27894525-27894547 ATGTCTAAGGAAAATATTGAAGG - Intergenic
971667876 4:29515013-29515035 CTGCCCAAGGAGAAAAGTGATGG - Intergenic
973615034 4:52669884-52669906 CTGTCTGCGGAGAAGATGGAGGG - Intergenic
974155302 4:58063680-58063702 ACTTCGAAGGACAAGATTGATGG - Intergenic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
977405195 4:96588965-96588987 ATGTCGAACAAGAAGTTTGAAGG - Intergenic
982815543 4:159878969-159878991 CAGGTGAAGGAGAGGATTGAGGG - Intergenic
985027051 4:185748403-185748425 GTGTGGAAGAATAAGATTGATGG - Intronic
985412582 4:189701115-189701137 GTGGTGAAGGAGAAGATTGTTGG + Intergenic
986291997 5:6407589-6407611 CTCTGGAAGGAGAAGAGGGAAGG - Intergenic
986960334 5:13202889-13202911 GTGTCCAAGAAGAAGTTTGATGG - Intergenic
989733780 5:44678965-44678987 CTTTTGAAGGAAAACATTGAGGG + Intergenic
995178157 5:109202716-109202738 CAGTCAAAGGAGAAGATACATGG + Intergenic
995909009 5:117163305-117163327 CTGTAGAAGCAGAAGTTTCATGG + Intergenic
996798402 5:127376022-127376044 CTGTAGAAGAAGTAGATTGAGGG + Intronic
1003949059 6:11101495-11101517 CTTCCGAAGGAGGAGATGGAAGG + Intronic
1004891848 6:20108489-20108511 CTATAGAAAGAGAAGGTTGAGGG - Intronic
1006926299 6:37657353-37657375 CTGTGGAAGGGGCAGAATGATGG - Intronic
1006991429 6:38218000-38218022 CTTCCTAAGGAGTAGATTGAAGG - Intronic
1011647080 6:89469924-89469946 CTGTAGAAGGAGAAGAATCTGGG - Intronic
1017438736 6:154442772-154442794 CTGTGGAAGGAGCAGAGAGAAGG - Intronic
1018020135 6:159754761-159754783 CTGTAGAAGGAAAATATTCAAGG - Intronic
1021049408 7:15964256-15964278 CTGTCAAAGGAGAAAAGAGATGG + Intergenic
1022637768 7:32153453-32153475 GTGTGGATGGAGAAGAATGAAGG + Intronic
1023382619 7:39623695-39623717 CGGTCGAAGGAGGAGTCTGACGG - Exonic
1024435214 7:49344885-49344907 CTGACGTAAAAGAAGATTGATGG - Intergenic
1025214609 7:57045514-57045536 ATGATGAAGGATAAGATTGATGG - Intergenic
1025657344 7:63531294-63531316 ATGATGAAGGATAAGATTGATGG + Intergenic
1026537837 7:71254889-71254911 CTGTCTGAGGAGAAGATTCTGGG + Intronic
1027595717 7:80171418-80171440 CTGACGAAGAAAAATATTGAAGG + Intronic
1032172337 7:129595539-129595561 AGGTAGAAGGAGAATATTGAAGG + Intergenic
1035674211 8:1443469-1443491 CTCTTGCAGGAGAAGACTGAGGG - Intergenic
1036929556 8:12941635-12941657 CATTCGCAGGAGAAGATTGCAGG - Intergenic
1037626920 8:20616172-20616194 CTGTATAAGGAGAATAGTGAAGG - Intergenic
1040083556 8:43313716-43313738 CTGTTGAATGAGAAAATTTAGGG + Intergenic
1042738388 8:72014719-72014741 CCTTCAAAGGAGAAGATTTAAGG - Intronic
1043211814 8:77529045-77529067 CTATGGAAGGAGATGATTTAGGG + Intergenic
1043305179 8:78784871-78784893 CTTTTCAAGGAGAAGATGGAGGG - Intronic
1045565560 8:103311010-103311032 CTGACTAAGCAGAAAATTGATGG + Intronic
1047140074 8:122128501-122128523 CTGTAGAAGGAAAAGATGCAAGG + Intergenic
1048207159 8:132424411-132424433 CTGTCGAATGAGAGGGTTGGGGG - Intronic
1049969521 9:809386-809408 CTTTCTAAGGAGAAAATTTATGG - Intergenic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051844143 9:21432751-21432773 CTGGCAAAGAAGAAGAATGAAGG - Intronic
1053260196 9:36656263-36656285 CTGACAAAGTAGAAGATGGAGGG - Intronic
1055067041 9:72129606-72129628 CTGTGGAACTATAAGATTGAAGG - Intronic
1055481213 9:76710734-76710756 CTGCAGAATGAGAAGATTGCTGG + Exonic
1059619253 9:115985252-115985274 ATGTAGAAGGAGAAAACTGAGGG - Intergenic
1061471500 9:130830147-130830169 CTCTAGAAGGAGAAAATTAATGG - Intronic
1062740778 9:138174119-138174141 CTGGAGAAGGAGAAAATTGCTGG - Intergenic
1203670009 Un_KI270755v1:1867-1889 GTGGTGAAGGAGAAGATTGTTGG - Intergenic
1186960417 X:14730565-14730587 TTGACAGAGGAGAAGATTGAGGG + Exonic
1187254504 X:17629988-17630010 CTGTCAAGGGAGAAGAGAGAGGG + Intronic
1188411696 X:29880684-29880706 CTGTCAAAAGGGAAGTTTGATGG - Intronic
1192432951 X:71125057-71125079 CCACCCAAGGAGAAGATTGAAGG + Exonic
1192442523 X:71185230-71185252 CTGTTGAAAGAGTAGATGGAAGG - Intergenic
1192533103 X:71906321-71906343 CTGCCCTAGGAGATGATTGATGG + Intergenic
1194818336 X:98473198-98473220 CTGTAAAAGGGGAAAATTGACGG + Intergenic
1196820662 X:119697859-119697881 ATATTGAAGGAGAAGTTTGAAGG + Intergenic
1199904955 X:152216635-152216657 CTGGGGAAGGAGAAGAGAGAGGG + Intronic
1200142379 X:153908559-153908581 CTCTCGAAGGAGCAGAGCGAAGG - Intronic
1201069260 Y:10129498-10129520 CTGGAGAAGGAGAAAATTGCTGG - Intergenic
1201759311 Y:17519902-17519924 CTGGAGAAGGAGAAAATTGCTGG + Intergenic
1201842243 Y:18386088-18386110 CTGGAGAAGGAGAAAATTGCTGG - Intergenic