ID: 919748626 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:201023474-201023496 |
Sequence | GGCGCGGGCGCGGCTGGCGG AGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 1076 | |||
Summary | {0: 1, 1: 1, 2: 14, 3: 138, 4: 922} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
919748610_919748626 | 16 | Left | 919748610 | 1:201023435-201023457 | CCAATGCCCGAGGCAGCGGCTGC | 0: 1 1: 0 2: 1 3: 16 4: 176 |
||
Right | 919748626 | 1:201023474-201023496 | GGCGCGGGCGCGGCTGGCGGAGG | 0: 1 1: 1 2: 14 3: 138 4: 922 |
||||
919748613_919748626 | 9 | Left | 919748613 | 1:201023442-201023464 | CCGAGGCAGCGGCTGCGGCTGCG | 0: 1 1: 0 2: 8 3: 82 4: 611 |
||
Right | 919748626 | 1:201023474-201023496 | GGCGCGGGCGCGGCTGGCGGAGG | 0: 1 1: 1 2: 14 3: 138 4: 922 |
||||
919748612_919748626 | 10 | Left | 919748612 | 1:201023441-201023463 | CCCGAGGCAGCGGCTGCGGCTGC | 0: 1 1: 0 2: 12 3: 113 4: 683 |
||
Right | 919748626 | 1:201023474-201023496 | GGCGCGGGCGCGGCTGGCGGAGG | 0: 1 1: 1 2: 14 3: 138 4: 922 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
919748626 | Original CRISPR | GGCGCGGGCGCGGCTGGCGG AGG | Exonic | ||