ID: 919748626

View in Genome Browser
Species Human (GRCh38)
Location 1:201023474-201023496
Sequence GGCGCGGGCGCGGCTGGCGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1076
Summary {0: 1, 1: 1, 2: 14, 3: 138, 4: 922}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919748610_919748626 16 Left 919748610 1:201023435-201023457 CCAATGCCCGAGGCAGCGGCTGC 0: 1
1: 0
2: 1
3: 16
4: 176
Right 919748626 1:201023474-201023496 GGCGCGGGCGCGGCTGGCGGAGG 0: 1
1: 1
2: 14
3: 138
4: 922
919748613_919748626 9 Left 919748613 1:201023442-201023464 CCGAGGCAGCGGCTGCGGCTGCG 0: 1
1: 0
2: 8
3: 82
4: 611
Right 919748626 1:201023474-201023496 GGCGCGGGCGCGGCTGGCGGAGG 0: 1
1: 1
2: 14
3: 138
4: 922
919748612_919748626 10 Left 919748612 1:201023441-201023463 CCCGAGGCAGCGGCTGCGGCTGC 0: 1
1: 0
2: 12
3: 113
4: 683
Right 919748626 1:201023474-201023496 GGCGCGGGCGCGGCTGGCGGAGG 0: 1
1: 1
2: 14
3: 138
4: 922

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919748626 Original CRISPR GGCGCGGGCGCGGCTGGCGG AGG Exonic