ID: 919748626

View in Genome Browser
Species Human (GRCh38)
Location 1:201023474-201023496
Sequence GGCGCGGGCGCGGCTGGCGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1076
Summary {0: 1, 1: 1, 2: 14, 3: 138, 4: 922}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919748612_919748626 10 Left 919748612 1:201023441-201023463 CCCGAGGCAGCGGCTGCGGCTGC 0: 1
1: 0
2: 12
3: 113
4: 683
Right 919748626 1:201023474-201023496 GGCGCGGGCGCGGCTGGCGGAGG 0: 1
1: 1
2: 14
3: 138
4: 922
919748610_919748626 16 Left 919748610 1:201023435-201023457 CCAATGCCCGAGGCAGCGGCTGC 0: 1
1: 0
2: 1
3: 16
4: 176
Right 919748626 1:201023474-201023496 GGCGCGGGCGCGGCTGGCGGAGG 0: 1
1: 1
2: 14
3: 138
4: 922
919748613_919748626 9 Left 919748613 1:201023442-201023464 CCGAGGCAGCGGCTGCGGCTGCG 0: 1
1: 0
2: 8
3: 82
4: 611
Right 919748626 1:201023474-201023496 GGCGCGGGCGCGGCTGGCGGAGG 0: 1
1: 1
2: 14
3: 138
4: 922

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919748626 Original CRISPR GGCGCGGGCGCGGCTGGCGG AGG Exonic
900091835 1:924108-924130 GGCGCGGGCGCTGGTGGCCGGGG + Intergenic
900162826 1:1232417-1232439 CGCGCGGGCGCGGGGGGAGGCGG - Exonic
900205012 1:1427933-1427955 GGCGGGGGCGGGGCTGCGGGCGG - Intergenic
900237476 1:1599701-1599723 GGCGCGCACGCGGCGCGCGGCGG + Exonic
900243684 1:1628291-1628313 GGCTCGGGCGCGGCAGCTGGTGG + Exonic
900258871 1:1712297-1712319 GGAGCGCGAGCGGCGGGCGGAGG - Exonic
900307681 1:2019183-2019205 GGAGGGGGCGCGGCTGGCGGAGG + Intergenic
900318445 1:2070728-2070750 GGCCAGGGTGGGGCTGGCGGGGG + Intronic
900318461 1:2070769-2070791 GGCTGGGGTGGGGCTGGCGGGGG + Intronic
900342259 1:2194740-2194762 GGCGCGGGCTTGGATGGAGGCGG - Exonic
900468181 1:2835882-2835904 GGGAGGGGCGCGGCTGGCAGTGG - Intergenic
900946189 1:5832582-5832604 GGAGGGGGCGCGTCTGGAGGAGG + Intergenic
901012373 1:6209093-6209115 GCTGCGGGGGCGGCGGGCGGTGG - Exonic
901016620 1:6235671-6235693 GGGGCCGGCGGGGCGGGCGGCGG - Intronic
901022138 1:6260920-6260942 GCCGCGGGGGTGGCTGGCGGCGG + Exonic
901022213 1:6261152-6261174 GGCGGGGGCGGGGCGGGCCGAGG - Intergenic
901028859 1:6294424-6294446 GGCGTGGGCAGGGCTGGCCGAGG + Intronic
901057626 1:6456021-6456043 GGGGGAGGCGCGGCGGGCGGGGG - Intronic
901109820 1:6785601-6785623 GGGGGCGGCGCGGCGGGCGGCGG + Intronic
901361308 1:8703231-8703253 GGCGCGGGCGCAGGTCCCGGCGG + Intronic
901399645 1:9007104-9007126 GGCGCTGGCCTGGCTGGCGCTGG + Intronic
901426067 1:9182954-9182976 GGCGCCGGGCCGGCGGGCGGTGG - Intergenic
901433884 1:9234727-9234749 GGCGGGGGCGCGCGCGGCGGGGG - Intergenic
901433991 1:9235075-9235097 GGCGGCGGCGGGGCCGGCGGGGG - Intronic
901506575 1:9689443-9689465 GGCGGGGCCGGGGCCGGCGGCGG - Intronic
901641371 1:10694698-10694720 GGCGCGGGCGCGCGCGGCGGGGG - Intronic
901641432 1:10694887-10694909 AGCGCGCGCGCGGCCGCCGGCGG - Intronic
901660311 1:10794908-10794930 CGCGCTGGGGCCGCTGGCGGGGG - Intronic
901791349 1:11654986-11655008 GGAGGGGGCGCGGCTGGGCGGGG + Intronic
902067487 1:13700279-13700301 GGCGCTGGCGCGGCGGGCGCGGG + Intronic
902920723 1:19664941-19664963 GCCGCGGGCCGGGCGGGCGGCGG - Intergenic
902940984 1:19799973-19799995 GGCGCGCTCGGGGCAGGCGGCGG - Intergenic
903069100 1:20717826-20717848 GGCGGGGCCGCGGCGGGGGGCGG + Exonic
903750181 1:25616692-25616714 GGCGCGGCGGCGGCGGGAGGGGG + Intergenic
904199783 1:28812262-28812284 GGCCGGGGCGCGGCAGCCGGCGG + Exonic
904334085 1:29785788-29785810 GGCGGGGGCGGGGCTGGGGGTGG - Intergenic
904618960 1:31764163-31764185 GGCGCGGGCGGTGCTCGGGGCGG - Intronic
904751121 1:32741928-32741950 GGCGGGGGCGGAGCGGGCGGCGG - Exonic
904782989 1:32964536-32964558 GGCCCGGGCGCGGCGGCCGCGGG + Exonic
905151371 1:35930822-35930844 GACGACGTCGCGGCTGGCGGCGG - Intronic
905546498 1:38804301-38804323 GGCGCCCGCGCTGCTGCCGGCGG - Intergenic
905789792 1:40783963-40783985 GGGGCGGGCGCGGGCGGCGGGGG - Intergenic
906044393 1:42817032-42817054 GGGGCGGGCCCGGCTGGCTATGG - Intronic
906140489 1:43531229-43531251 GCTGCGGGCGCGGCAGGTGGGGG - Intronic
906365360 1:45205830-45205852 GGGGCCGGCGCGGCCGGCTGCGG - Exonic
906488160 1:46247487-46247509 GGCGGGGGCGGGGGTGGCGGGGG - Intergenic
906615837 1:47232253-47232275 GGCGGGCGCGGGGCGGGCGGGGG - Intergenic
906627026 1:47333829-47333851 GGCGGGGCCGCGGCGGGCGCCGG + Exonic
906720092 1:47997746-47997768 GGCCCGGTCGCGCCTGGCGAAGG - Intergenic
907012577 1:50977741-50977763 GGCGAGGTCGCGGCAGGAGGGGG - Intergenic
907051091 1:51330388-51330410 GGCGCGGGCGGCGCGGGCTGGGG - Intronic
907188991 1:52633261-52633283 GGGGCAGGCGGGGCGGGCGGCGG - Intergenic
907486517 1:54781731-54781753 GGTGCAGGAGCTGCTGGCGGTGG - Exonic
907766875 1:57421900-57421922 GGCGGGGGGGGGGGTGGCGGGGG + Intronic
907767361 1:57424150-57424172 CGGGCGGGCGCGGGGGGCGGCGG - Intronic
908501161 1:64745074-64745096 GGCGAGGGCGAGGCGGGCAGAGG - Exonic
908534818 1:65067347-65067369 GGCTCCGGCGAGGCTGGCCGCGG - Intergenic
908581966 1:65525728-65525750 CGCGCGCGCTCGGCTGGCCGTGG - Intronic
910549745 1:88462767-88462789 GGCGCGGGCGGGCCGGGCGGAGG - Intergenic
910758876 1:90716891-90716913 GTCGGGGCCGCGGCCGGCGGCGG + Exonic
910963354 1:92784735-92784757 GGCCGAGGCGCGGCGGGCGGGGG - Intronic
911527590 1:99004916-99004938 GGGGCGGGCGGCGCTTGCGGCGG - Intronic
912433725 1:109643808-109643830 AGCGCGGGAGAGGCAGGCGGAGG + Intergenic
912514671 1:110210417-110210439 GGCTCGCGCGCGGCAGGGGGCGG - Intergenic
915463186 1:156081730-156081752 GCCGGGGGCGCCGCGGGCGGCGG + Exonic
916651667 1:166839612-166839634 CGCGCGGGCGGGGGCGGCGGCGG + Intronic
917659656 1:177164746-177164768 GGAGCGAGCGCGGGAGGCGGGGG + Intronic
917905854 1:179586653-179586675 GGCGGGGGCGGGGGCGGCGGGGG + Intergenic
919748626 1:201023474-201023496 GGCGCGGGCGCGGCTGGCGGAGG + Exonic
919928895 1:202208631-202208653 GGCGTGGCGTCGGCTGGCGGGGG - Intronic
920071339 1:203305352-203305374 GGCGGGGGCTGGGGTGGCGGGGG + Intergenic
920333255 1:205227712-205227734 GGGGCGGGGGCGGCGGGCGTGGG - Intergenic
922169517 1:223143115-223143137 GGCGGGGACGCGGCTGCCTGCGG - Intronic
922739356 1:228006857-228006879 GGCCCGGGCGGGGCAGGCAGGGG - Intergenic
922821274 1:228487441-228487463 GGCGCAGGAGCGGCTGGGGAGGG - Exonic
923007849 1:230066860-230066882 GGGGAGGGGGCGGCCGGCGGGGG + Intronic
923055982 1:230426156-230426178 GCCGCGCGCGGGGCTGGCAGGGG + Intergenic
923506789 1:234611156-234611178 GGCGAGGGCGCGAGTGGGGGGGG + Intergenic
923783231 1:237043300-237043322 TGCGCGCGCGCGGGTGGTGGTGG + Intronic
924008946 1:239643481-239643503 GGCGGCAGCGCGGCTGGGGGAGG - Intronic
924421865 1:243917316-243917338 GGCGAGGTCGGGGCTGGGGGTGG + Intergenic
1062795824 10:344386-344408 GGCGGGGGCGGGGCGGGGGGGGG + Intronic
1062855795 10:778912-778934 GGAGGGGGCTCGGCTGGCGCTGG + Intergenic
1063115539 10:3068986-3069008 GGGGCGGGCGCGGGTGCCGCAGG + Intronic
1063298060 10:4826300-4826322 GGCGGCGGGGCGGCCGGCGGCGG + Exonic
1063657769 10:8009148-8009170 GGGGCGGGCGCGGGGGCCGGCGG - Exonic
1063776179 10:9267847-9267869 GGCGGGGGCGGGGGTGGGGGAGG - Intergenic
1064380504 10:14837969-14837991 GCGGTGGGCGCGGGTGGCGGAGG - Exonic
1064418232 10:15168721-15168743 GGCGCGGGCGGGGCGGGGCGGGG - Intergenic
1064662204 10:17617409-17617431 GGCGGGGGCGTGACGGGCGGTGG - Intergenic
1065046645 10:21752176-21752198 GGCACGGGAGCGGCTGGGGGAGG - Intergenic
1065189236 10:23195168-23195190 GGCGCGCGCGCAGATGGCGTTGG + Intergenic
1065214876 10:23439509-23439531 GGCGCGGGGGCGGCGGCCGTGGG - Exonic
1065418993 10:25520953-25520975 GGCGCCAGCGAGGCTGGGGGAGG - Intronic
1065520572 10:26567288-26567310 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1065520574 10:26567294-26567316 GGCGCGGGCGCGGGCGGCGGCGG - Exonic
1066429222 10:35336474-35336496 AGGGCGGGCGCCGCTGGCGAGGG + Intronic
1066464395 10:35640318-35640340 GGCGCGGGCGCGGGCGGCCCGGG - Exonic
1066464400 10:35640333-35640355 GGCGCGGGCGCGGCGGGCGCGGG - Exonic
1066464881 10:35642277-35642299 GGCGCGAGCGGGGCTGGAGCCGG - Exonic
1067769898 10:49115540-49115562 GGCCCGGGGCGGGCTGGCGGCGG - Intergenic
1068560812 10:58512876-58512898 CGCGCGGGCGTTGCTGGCGGGGG + Intergenic
1069718034 10:70533079-70533101 GGCACGGGCGCGCATGGGGGAGG + Intronic
1070112045 10:73495837-73495859 GGCGGGGGCGGGGGTGGGGGCGG + Exonic
1070327750 10:75399501-75399523 GGTGGGGGCGCAGCTGGCGGCGG - Exonic
1070327958 10:75400241-75400263 GGCGCGGGCGGTGCCGGCGGCGG - Exonic
1071086825 10:81875239-81875261 GGCGCGGGCTCCGGCGGCGGCGG - Intergenic
1071086827 10:81875245-81875267 GGCGCGGGCGCGGGCTCCGGCGG - Intergenic
1071086895 10:81875443-81875465 GGCGGGGGCCCGGACGGCGGCGG + Exonic
1071248057 10:83786648-83786670 GGCGGGAGCGAGGCTGGGGGAGG - Intergenic
1071847575 10:89535832-89535854 GGCGCCGGCGAGGCTGGGGCCGG + Intronic
1071997516 10:91162870-91162892 GGCGGCGGCGGCGCTGGCGGCGG - Intergenic
1072021837 10:91410285-91410307 GGCGCGGGCGCGGGCGGGGGCGG + Exonic
1072102211 10:92239833-92239855 GGCGCGGGCGCAGGCGGCGGCGG + Exonic
1073025651 10:100485558-100485580 GGCGCTGGTGGTGCTGGCGGTGG + Intergenic
1073414228 10:103368080-103368102 GGCGCAGGCGAGGGTAGCGGCGG + Exonic
1073503897 10:103967244-103967266 GCCGCGGGAGCGGACGGCGGCGG + Exonic
1073504021 10:103967646-103967668 CGCGCGAGCCCGGCTGGCGGCGG - Exonic
1075207014 10:120456985-120457007 GGCGCGGGCCCAGGAGGCGGAGG + Exonic
1076096350 10:127737255-127737277 GGCCCGGGCGCGGCTGGACATGG + Exonic
1076633208 10:131865381-131865403 GGGGCTGGAGGGGCTGGCGGTGG + Intergenic
1076650240 10:131982235-131982257 GTCGCCGCCGCGGCGGGCGGTGG + Intergenic
1076792752 10:132785728-132785750 CCCGTGGGCGCGGCGGGCGGGGG - Exonic
1076879102 10:133231215-133231237 GACGGGGGCGCGGCCGGAGGGGG - Exonic
1076986007 11:236426-236448 GGGGCGGGGGCGGTAGGCGGAGG - Exonic
1076993921 11:289317-289339 GGGGCAGGCGCGGGTGGGGGAGG - Intronic
1077008540 11:370031-370053 GGCGCGGGCGGCGCGGGCGGCGG + Intronic
1077024929 11:434929-434951 GGCGAGGATGCGGCTGGCAGAGG - Intronic
1077034821 11:489532-489554 CGCGACGGCGCGGCGGGCGGGGG + Intronic
1077067062 11:646356-646378 GGCCCGGGAGGGGCGGGCGGTGG - Intronic
1077100402 11:819913-819935 GGGCCGGGGGCGGCAGGCGGGGG + Intronic
1077333895 11:1994888-1994910 GGCGGGGGCTGGGCTTGCGGAGG - Intergenic
1077419727 11:2444712-2444734 GGCTCGGGCGGGGGTGGGGGTGG + Intronic
1077635892 11:3841071-3841093 GCCGGGGGCGAGGCTGGGGGCGG - Intergenic
1077923101 11:6655876-6655898 GGCGGGGGCTCCGCGGGCGGAGG - Intergenic
1078246136 11:9574234-9574256 GGCGCGGACGAGGCGGGCGGTGG + Exonic
1078800894 11:14643630-14643652 GGCCGCGGCGCGGGTGGCGGCGG + Intronic
1079023192 11:16925407-16925429 GGCGCGGGCGTGACTGGAGCCGG - Intronic
1080386507 11:31813951-31813973 GGTGCGGGCGCGGTTGCCAGAGG + Intronic
1080458440 11:32434942-32434964 GGCGGCGGCGGGGGTGGCGGCGG + Exonic
1080503770 11:32893165-32893187 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1080802229 11:35619056-35619078 GGCGGCGGCGTGGCTGGAGGCGG + Exonic
1081636875 11:44727312-44727334 GGCGCGGCGGCGGCGTGCGGAGG - Intronic
1081831476 11:46119887-46119909 GGCGGGGGCGCGGGCGGGGGAGG + Intronic
1081831915 11:46121550-46121572 GGCGGGGGCGCGCACGGCGGCGG - Intergenic
1082795735 11:57376641-57376663 GGCCCGGTGGGGGCTGGCGGCGG - Intergenic
1082824448 11:57567703-57567725 GGGGTGGGCGGGGCTGCCGGGGG - Exonic
1083639636 11:64138576-64138598 GCCGCGGGCCCTGCTGGCAGAGG + Intronic
1083657043 11:64234722-64234744 GGCCCGGGCGCGGCGGGCGGGGG - Exonic
1083684550 11:64368615-64368637 GGCGCGGGCAGGGGTGGGGGTGG + Intronic
1083797745 11:65027447-65027469 GGCGAGGCGGCGGCGGGCGGAGG + Exonic
1083920509 11:65779682-65779704 GGCGCGGGAGCTGCGGGCTGCGG - Exonic
1083970203 11:66070043-66070065 GGCGGGGCCGCGGCCGGCCGTGG + Intergenic
1084070081 11:66728186-66728208 GGCGGGGGCGCGGCGGGCGGGGG + Intronic
1084070122 11:66728320-66728342 GGGGCGCGCGGGGCGGGCGGCGG + Intronic
1084151230 11:67288954-67288976 CGCGCGTGCGCGGCGGGCCGCGG - Intronic
1084169098 11:67391942-67391964 GGCGGGGGCGGGGCCGGCAGGGG + Exonic
1084265611 11:68003868-68003890 GGCGGGGGCGGGGCGGGCCGGGG - Intronic
1084295928 11:68213435-68213457 GGCGCGGGGGCGGGCGCCGGGGG - Intronic
1084310225 11:68312511-68312533 GCGGGGGGCGCGGGTGGCGGCGG + Intergenic
1085037473 11:73308842-73308864 GGAGCGGGCGCGGCTGCGCGGGG - Exonic
1085173494 11:74467596-74467618 GGCCCGGGCGGGGCAGGGGGAGG - Exonic
1085208148 11:74749316-74749338 GACGGGGGCGCGGCTGCCGCGGG + Exonic
1085266795 11:75242142-75242164 CCCGCGGGCGCGGCGGGCGCGGG - Exonic
1087188756 11:95230945-95230967 GGCGGAATCGCGGCTGGCGGCGG - Exonic
1088685320 11:112280139-112280161 GGCGTGGGCGGGGCGGGTGGGGG + Intergenic
1089209457 11:116790557-116790579 GAGGCGCGCGGGGCTGGCGGGGG + Exonic
1089374750 11:117986364-117986386 GGCGCTGGCGGAGCGGGCGGCGG + Exonic
1089515857 11:119030898-119030920 TGCGCAAGCGCGGCCGGCGGGGG + Exonic
1089573153 11:119423140-119423162 GGCGGCGGCGCGTCTGGAGGAGG - Exonic
1089993424 11:122882890-122882912 GGCGGGGGCCCGGGCGGCGGCGG + Exonic
1090190137 11:124761870-124761892 GGTGTGGGGGCGGATGGCGGGGG - Intronic
1090198775 11:124839411-124839433 AGCGCGGCCGGGGCTGGGGGCGG + Intergenic
1090699075 11:129278918-129278940 GGCGCGGGCGCGGGAGGCGGTGG + Intronic
1091273110 11:134331866-134331888 AGCGGGGGCGGGGCTGGCCGGGG - Exonic
1202816878 11_KI270721v1_random:50070-50092 GGCGGGGGCTGGGCTTGCGGAGG - Intergenic
1091434024 12:459913-459935 GGCGGGGGCGGGGCCGGGGGCGG + Intergenic
1091434231 12:460572-460594 GGCGCGGGGGTGGGCGGCGGCGG + Intronic
1091550043 12:1530260-1530282 GGGGCCGGCGCGGCTGTCGGGGG + Intronic
1091616203 12:2052927-2052949 GGCGCGGGCGCGGCGGGGCTGGG + Intronic
1091718390 12:2795486-2795508 GGCCCGGGCGCTGCCGGCTGGGG - Intronic
1091759606 12:3077877-3077899 GGAGCGGTCGCGGGTGCCGGGGG - Intronic
1091915659 12:4270658-4270680 GGCGCGGGGGTGGGGGGCGGCGG - Intergenic
1092843341 12:12562953-12562975 CGCGCGGGCGCGGGAGGAGGAGG - Intergenic
1094218512 12:27970350-27970372 GGCGGGCGCGCGGGGGGCGGGGG + Intronic
1095261664 12:40105630-40105652 AGCGCGGGCGCGGGCGGCGGCGG - Exonic
1095687239 12:45050484-45050506 GGCGCGGGCGCGGCTGGGGAGGG + Intronic
1096080200 12:48827926-48827948 GGCACAGGCGCAGCTGGCTGGGG + Exonic
1096251028 12:50032838-50032860 CGCGCGGGGGCGGCAAGCGGGGG + Intronic
1096382799 12:51173072-51173094 GGCGCTGGGGCGGCGGACGGTGG - Intronic
1096435921 12:51591121-51591143 CGCGGGGGCGGGGCGGGCGGGGG + Intronic
1096601841 12:52735316-52735338 GGAGCGGGGTCGGCTGGAGGGGG - Intergenic
1096647589 12:53047184-53047206 GGCGCGGGCGCGGGGCGCGGCGG + Intronic
1096647634 12:53047331-53047353 GGCGGGGGCGCGGCGGGGCGGGG - Intronic
1096784415 12:54009057-54009079 GGCGCGGGCGGCGGCGGCGGCGG - Intronic
1096784417 12:54009063-54009085 GGCTGGGGCGCGGGCGGCGGCGG - Intronic
1097925392 12:65121431-65121453 GGCGCGGGCGGGAGTGGGGGCGG + Exonic
1098029055 12:66235420-66235442 CGCGCGGCGGCGGCCGGCGGGGG + Intronic
1098943124 12:76559811-76559833 GGGGCGGGCGGGGCAGGGGGAGG - Intergenic
1100679850 12:96907332-96907354 TGCGCGGACGCGGCGGGCGGGGG - Intronic
1100869498 12:98895167-98895189 GGCCCAGGCGCGGCGCGCGGGGG + Intronic
1101226177 12:102690217-102690239 GGCGAGGGGGCGGGGGGCGGGGG + Intergenic
1101605981 12:106247952-106247974 CACGCGGGCGCTGCTGGCGTCGG + Exonic
1101606072 12:106248198-106248220 GGCGCGGGGGTGGCTGGGCGCGG + Intronic
1101910519 12:108857545-108857567 GGCCCGGGCGGCGGTGGCGGTGG - Exonic
1102122128 12:110450046-110450068 GGCGGGGGCGCGGCAGGAGTGGG - Intronic
1102298839 12:111756906-111756928 GGGGCGGCCACGGCGGGCGGTGG + Exonic
1103348347 12:120265739-120265761 GGCGCGGGCGCGCGCGGCGGCGG - Exonic
1103432921 12:120903773-120903795 GGCGCCGGCGCGGCCCGCCGAGG - Intronic
1103488198 12:121296743-121296765 GGCGGGCGCGCGGGGGGCGGGGG + Intronic
1103561915 12:121797344-121797366 GGCGGGGCCGCTGCTGGCGCTGG - Intronic
1103595423 12:122022198-122022220 GCCGGGGAGGCGGCTGGCGGCGG - Intronic
1103698542 12:122835643-122835665 GGCGAGCGGGCGGCGGGCGGCGG + Exonic
1103800309 12:123533606-123533628 GGCGAGGGCGCAGCGGGCAGCGG + Exonic
1103954281 12:124567658-124567680 GGCGCGAGCCCGGGAGGCGGTGG + Intergenic
1104049497 12:125186287-125186309 GGCGGGGCCGCGGCCGGGGGAGG - Intergenic
1104376191 12:128267108-128267130 GGCGGGGGCGGGGCCGGGGGCGG + Intergenic
1104448820 12:128853499-128853521 GGCGCAGACGCGGACGGCGGGGG - Intronic
1104448907 12:128853740-128853762 GGCCCCGGCGCGGCTGGAGGGGG - Intronic
1104857578 12:131909308-131909330 GGCGCGGGCAGGGCTCGCAGGGG - Intronic
1104929379 12:132329790-132329812 CGCGCGGGCGCGGGGAGCGGGGG + Intergenic
1105011895 12:132761774-132761796 GCTGTGGCCGCGGCTGGCGGCGG - Exonic
1105368525 13:19782603-19782625 GGCGCGGGCGCGGGCGGTGCCGG + Exonic
1105698605 13:22915846-22915868 GGCGCGGGTGCGGGTGGTGATGG - Intergenic
1105975467 13:25468765-25468787 GGCGTGGGCGGGGCCGGGGGCGG + Intronic
1106248423 13:27967128-27967150 GTCTGGGGCGCGGTTGGCGGGGG - Intronic
1107133529 13:36920367-36920389 TGCGCGGGCCCGGCGGGGGGCGG + Intronic
1107467547 13:40664825-40664847 GGGGCGGGCGCGGGCGGTGGCGG - Intronic
1107468143 13:40667087-40667109 GGCGCGGGGTGGGCGGGCGGAGG + Intergenic
1107549035 13:41457951-41457973 GGCGCGCGCGGAGCTGGTGGTGG - Intronic
1107605218 13:42049169-42049191 GGCGCGGGCGGGGCGGGGAGGGG + Intronic
1108389659 13:49936069-49936091 GGGCCGGGCGCGGCGGGCAGGGG - Intronic
1110318448 13:74135073-74135095 GGGCCGGGCGCGGCAGGCAGGGG + Intergenic
1110630153 13:77698106-77698128 GGGGGCGGCGCGGCGGGCGGCGG - Intronic
1110705973 13:78602256-78602278 GGCGCGGGCGCGGCGGCCGGCGG - Exonic
1111951421 13:94712075-94712097 GGCGAGGGCCCGGGAGGCGGCGG - Exonic
1112290887 13:98143339-98143361 CGCGCGAGCAGGGCTGGCGGTGG - Intronic
1112504965 13:99970075-99970097 GGCGCAGGAGCTGGTGGCGGCGG + Intronic
1112505078 13:99970573-99970595 TGCGCGGGCGCCGGCGGCGGCGG + Exonic
1112507855 13:99985575-99985597 GGCGGCGGCGGGGCGGGCGGCGG + Exonic
1112580879 13:100675150-100675172 GGGTCGGGCGAGGCTGGCTGCGG + Intergenic
1113201064 13:107867592-107867614 CGCGCGGGGGCGGGCGGCGGCGG + Intergenic
1113346699 13:109485315-109485337 GGGGCAGGGGCGGCGGGCGGGGG - Intergenic
1113379220 13:109787023-109787045 GGCGGGGCCGCGGCTGGGCGGGG + Intergenic
1113494022 13:110713929-110713951 GGCGCGGGCCGCGGTGGCGGTGG - Intronic
1113655996 13:112068085-112068107 GCGGCCGGCGCGGGTGGCGGCGG + Exonic
1113656012 13:112068136-112068158 GGCGTGGGCGCGGCGGCCGTGGG + Exonic
1113660862 13:112105575-112105597 TGCGCGGGTGCGGGAGGCGGAGG + Intergenic
1113794773 13:113050718-113050740 GGCGGGGGCGGGGGGGGCGGGGG + Intronic
1113935969 13:113995739-113995761 GACGGGGGCCCGGCTGACGGGGG + Intronic
1113935976 13:113995754-113995776 GACGGGGGCCCGGCTGACGGGGG + Intronic
1113948822 13:114059935-114059957 AACGCGGGCAAGGCTGGCGGGGG + Intronic
1114485156 14:23057640-23057662 CGCGCGGGCCCGGCTGGCCGGGG - Intergenic
1114736724 14:25050013-25050035 GGCGCGGGAGCCGCGAGCGGCGG - Exonic
1115474572 14:33800615-33800637 GGCGGCGGCGCGGGGGGCGGCGG + Exonic
1115851790 14:37595151-37595173 GGCGGCGGCGCGGCGGGCGGGGG + Intronic
1116547438 14:46186554-46186576 GGCGGGGGTGAGGCTGGAGGGGG - Intergenic
1116928605 14:50668037-50668059 GGCGCCGGCGGAGGTGGCGGCGG - Exonic
1116945288 14:50830731-50830753 GGCGCGGGCTGCGCGGGCGGGGG - Intronic
1117315590 14:54567854-54567876 GGGGCGGGCGGGGCGGGCTGGGG + Exonic
1119262542 14:73245998-73246020 GGCTCGGGCGGGGCGGGAGGTGG + Intronic
1119701980 14:76761797-76761819 GGCGCGGCCCGGGCGGGCGGAGG - Intergenic
1120881302 14:89417026-89417048 GCCGCGGGCGCGGGCGGCAGGGG + Intronic
1121535720 14:94689606-94689628 AGCCTGGGCGCGGCTGGCCGGGG + Intergenic
1121616990 14:95319924-95319946 GGCGCGGGCGCGGGCGGGGCGGG + Intergenic
1121616994 14:95319930-95319952 GGCGCGGGCGGGGCGGGGCGGGG + Intergenic
1121648172 14:95535186-95535208 GGCTCGGGCGCGGGCGGCGGCGG + Exonic
1122221174 14:100239809-100239831 GGGGCCGGCGCGGCGGGCGGCGG + Exonic
1122233376 14:100318433-100318455 GGCTCGGGCGCCGGTGGAGGAGG + Intergenic
1122418393 14:101561028-101561050 GGCGTGGGCGGCGTTGGCGGCGG + Intergenic
1122517681 14:102320023-102320045 GGAGCAGGCGCGGCAGGCGCGGG - Exonic
1122543346 14:102509645-102509667 GCGGCGGGCGCGGGCGGCGGTGG - Exonic
1122620952 14:103057445-103057467 GCCGCGGGCGGGGCTGAGGGCGG - Exonic
1122635324 14:103127048-103127070 GGCGCGGCCGCTGCTGGCGCTGG + Exonic
1122757961 14:103997565-103997587 GGCCAGGGAGCAGCTGGCGGGGG + Intronic
1122889045 14:104724208-104724230 GGCGCGGACGCCGGCGGCGGCGG + Intronic
1122910762 14:104826680-104826702 GGAGGGGGCGGGGCTGCCGGAGG + Intergenic
1122910771 14:104826698-104826720 GGAGGGGGCGGGGCTGCCGGAGG + Intergenic
1122917331 14:104865200-104865222 GGCGGGGGCGGGGCGGGCGGGGG + Intergenic
1122959450 14:105087756-105087778 GGCGCGGGGCGAGCTGGCGGGGG + Intergenic
1122975205 14:105168201-105168223 CGGGCGGGCGCGGCTGGGTGGGG - Intronic
1122985037 14:105208137-105208159 GGCGCGGGAGAGGATGGCTGGGG - Intergenic
1122993303 14:105248994-105249016 GGCGCGGGCGCGGGCGGCGGCGG - Exonic
1123004452 14:105314678-105314700 GGCGCGCGCGGGGCGGCCGGGGG + Exonic
1123040701 14:105489116-105489138 GGGGCGGGCGAGGCTGGCCTCGG + Intronic
1202899783 14_GL000194v1_random:28383-28405 GGCGCAGGCGCGGGGGGCGGGGG - Intergenic
1123585197 15:21753941-21753963 GGCAAGGGCTCGGCTGGAGGGGG - Intergenic
1123621844 15:22196548-22196570 GGCAAGGGCTCGGCTGGAGGGGG - Intergenic
1124327992 15:28783644-28783666 GGCGCGGTCTCGGCTCCCGGCGG + Intergenic
1124427056 15:29570980-29571002 GGAGCGCGCGGGGCGGGCGGGGG - Intergenic
1124453853 15:29822508-29822530 GGCGGGGGCGGGGCTGGACGAGG + Intronic
1124575503 15:30904105-30904127 GGCGCGGGCGCAGCTGCCCGCGG + Intronic
1124922222 15:34038609-34038631 CGCGGGGGCGCGCCTGGTGGCGG - Intronic
1125516462 15:40323838-40323860 GGCGGCGGCGGCGCTGGCGGCGG + Intergenic
1125535866 15:40441060-40441082 GGGGCGGGCGCGCCTGGCCGGGG - Intronic
1126109509 15:45167317-45167339 GGCGCGGGCGCGGCTGTGCCCGG + Exonic
1127071246 15:55289906-55289928 GGCCCCCGCCCGGCTGGCGGGGG + Intronic
1127117414 15:55742495-55742517 GGCGCGGACGCGGCCGGAGCCGG + Intronic
1128067879 15:64775643-64775665 GGGGCGGGCGCCGGCGGCGGGGG + Intergenic
1128315060 15:66654971-66654993 GGCGCGGGAGGGGCGGGCCGCGG - Intronic
1128374791 15:67066738-67066760 GCCGCGGGGGCGGGAGGCGGCGG - Intronic
1128547745 15:68579216-68579238 GGCGCGGGCGCGGCGTGCGGGGG - Exonic
1128582257 15:68818494-68818516 GGGTGGGGCGCGGGTGGCGGAGG - Intronic
1130301134 15:82680442-82680464 GGAGGGGGCGGGGCTGGGGGCGG + Intronic
1130531235 15:84748832-84748854 GGCCCGGGCCCGCCAGGCGGCGG - Intronic
1130945327 15:88546599-88546621 GGCGGGGGCGGGGCAGGGGGAGG - Exonic
1130997781 15:88913304-88913326 GGCGGGGGCGCGGCATGCTGCGG + Exonic
1131144346 15:90001681-90001703 GGCGGGGGCGCGGGGGGCGCGGG + Intronic
1131290150 15:91100185-91100207 TGCGCCTGGGCGGCTGGCGGGGG + Intronic
1132074689 15:98810133-98810155 GGTGTGGGGGTGGCTGGCGGAGG + Intronic
1132398236 15:101489579-101489601 GCCGCGGGCGCGGGGGGCGCGGG - Exonic
1132499819 16:280365-280387 GGCACGGGCCGGGCGGGCGGCGG + Intronic
1132499897 16:280619-280641 GGCGGCGGCGGGGCGGGCGGCGG + Exonic
1132512754 16:352466-352488 GGCGGGGGCGCGGCCCGGGGCGG + Exonic
1132544788 16:528085-528107 AGCGCGGGCCCGGAGGGCGGCGG + Intronic
1132560194 16:590042-590064 GGCGGCGGCGCGGCCGGGGGTGG + Intronic
1132585956 16:705833-705855 GGCGCGCGCGGCGCCGGCGGCGG - Intronic
1132588177 16:715212-715234 GGCGCGGGTCCGGGCGGCGGCGG - Exonic
1132683445 16:1153016-1153038 GCCGGGGGCGGGGCGGGCGGGGG - Intergenic
1132704370 16:1236840-1236862 GGCGCGGCCGAGGCAGGCGCTGG + Intergenic
1132707146 16:1249585-1249607 GGCGCGGCCGAGGCAGGCGCTGG - Intergenic
1132757508 16:1493305-1493327 GACGCGGGAGCGGGGGGCGGTGG - Intergenic
1132885324 16:2179763-2179785 GGCGGGGGTTCGGCAGGCGGGGG + Exonic
1132932872 16:2467827-2467849 GAGGCGGGCGCCGCTGGGGGAGG - Intergenic
1132982595 16:2746127-2746149 GGAGTGGGCGCGTCTGGCTGCGG + Intergenic
1133222582 16:4325128-4325150 GGCGCTGGAGGGGCTGGCTGGGG - Intronic
1134149830 16:11797051-11797073 GGCGCGCGCGGGGGGGGCGGGGG + Intronic
1134696983 16:16232527-16232549 TGCGCGGCGGCGGCTGGCGGCGG + Exonic
1135419755 16:22297755-22297777 GCCGCGGCCGACGCTGGCGGCGG + Intronic
1135517610 16:23148924-23148946 GGCGCGGGAGAGGCGGGCGGCGG + Exonic
1136281704 16:29217285-29217307 GTCGCGGGCGTTGCTGGCGGGGG + Intergenic
1136365179 16:29806417-29806439 GGCGGGGGCCCGGGCGGCGGCGG - Intronic
1136505315 16:30699041-30699063 CGCGCGTGCGCGGCTGGAGGCGG - Intronic
1136913659 16:34162619-34162641 GGCGCGGCCCCGGCTGGCCGAGG - Intergenic
1137426618 16:48385531-48385553 GGCGTTGGCGCGGCCGGCGGCGG + Intronic
1137531196 16:49280180-49280202 GTGGCGGGCGCGGCTGGATGGGG - Intronic
1137707908 16:50548275-50548297 GGCGGGGGCGGGGCCGGAGGCGG - Intergenic
1138179754 16:54933255-54933277 AGCGGCGGCGCGGCTGGCGGAGG + Exonic
1138514568 16:57528990-57529012 AGCGCGGGCGCGGGGGGCAGGGG + Exonic
1139528100 16:67528786-67528808 GGCGGCGGGGCGGCGGGCGGAGG + Intronic
1139597762 16:67968235-67968257 GGCGCGGGCGCCGGGGGCCGAGG + Intronic
1139917886 16:70439252-70439274 GGCGCGCGTGCGGGGGGCGGAGG - Intergenic
1140223155 16:73058341-73058363 GGCGCGGGCGCGGGGAGCGCGGG + Intronic
1140927571 16:79599175-79599197 GGCGGGGGCGCGGCGGGGGCGGG - Exonic
1141054587 16:80803939-80803961 GGCGCGGGCGCCGCGGGAGGCGG + Intronic
1141174048 16:81707799-81707821 GGAGCGGGCGGGACTGGCAGAGG + Intronic
1141608525 16:85169105-85169127 GGCGGGCGCGCGGCGGGCGGGGG - Intergenic
1141989568 16:87602427-87602449 GGGGCGGGGGCGGGGGGCGGGGG + Intronic
1142086081 16:88183202-88183224 GTCGCGGGCGTTGCTGGCGGGGG + Intergenic
1142156148 16:88533627-88533649 GGCGCGGGCGCGGGCGCCGGCGG + Exonic
1142173354 16:88634160-88634182 GCCGAGGGCACTGCTGGCGGGGG - Intergenic
1142267453 16:89071013-89071035 GGCGGGGGCGAGGGTGGCGTTGG - Intergenic
1142425719 16:90001290-90001312 GGCGCAGGCAGGGGTGGCGGGGG - Intergenic
1142509658 17:385831-385853 GGCGGGGACGCGGCGGGGGGTGG - Intronic
1142611092 17:1109482-1109504 TGCGGGGCCGCGGCTGGCGGAGG + Intronic
1142763765 17:2055198-2055220 GCCCCGGGCCCGGCTGACGGCGG - Intronic
1142799719 17:2337571-2337593 GCCGGGAGCGCGGCGGGCGGGGG + Exonic
1142811795 17:2399016-2399038 GCCGCCGCCGCGGCGGGCGGGGG - Intronic
1142876061 17:2852924-2852946 GGCTCGCGCGCGGCTGGCAGGGG + Intronic
1142986118 17:3696153-3696175 GGCGCGGGGGCGGGTCGGGGCGG + Exonic
1143196223 17:5078298-5078320 GGAGCCGGCTCGGCAGGCGGCGG + Exonic
1143223657 17:5282408-5282430 CCCGCGGGCTCAGCTGGCGGAGG - Exonic
1143482954 17:7238000-7238022 AGGACGGGGGCGGCTGGCGGCGG - Intronic
1143539761 17:7562005-7562027 GGCGGTGGCGCTGGTGGCGGCGG + Exonic
1143747269 17:9003589-9003611 GGCGCGGGCGCGGCAGGGCCGGG - Intergenic
1143750313 17:9022394-9022416 GGCGCTGGCGGCGCTGGCGGCGG + Exonic
1144021220 17:11241262-11241284 GGCGCGGGCGGCAGTGGCGGCGG - Exonic
1144438757 17:15262920-15262942 CGCGCGGGCGCGGTCGGCGTCGG - Intronic
1144756486 17:17682847-17682869 GGCGGGGGCGCGGCGGGCCTCGG + Intronic
1144784366 17:17823671-17823693 GGCTGGGGCGGGGCTGGGGGCGG - Intronic
1145014402 17:19387228-19387250 GGGGCTGGGGCGGCTGGCGGGGG - Intronic
1145884198 17:28371489-28371511 GGCGTGGGCGTGGCTGGGGACGG + Intronic
1145937981 17:28726276-28726298 GGGGCGCGGGCGGCTGGGGGCGG - Intronic
1145937983 17:28726280-28726302 GGCGGGGGCGCGGGCGGCTGGGG - Intronic
1146255993 17:31391802-31391824 GCGGCGGGCGCGGCGGGCGAGGG + Exonic
1146339655 17:32007830-32007852 GGCGCGGGGCGGGCCGGCGGCGG - Intergenic
1146773125 17:35587390-35587412 GGCGAGGGCGGGGGTGGCGGCGG - Exonic
1147168603 17:38605708-38605730 GGCGGGGGCGCGGGGGGCGGGGG + Exonic
1147179103 17:38673831-38673853 GCCTCGGGGGCGGCCGGCGGGGG + Exonic
1147184264 17:38705219-38705241 GGCGCGTGAGCGGGTGGCGCGGG + Intergenic
1147184381 17:38705583-38705605 GGCGGGGGGCCGGCCGGCGGGGG - Exonic
1147264363 17:39225846-39225868 GGGGCGGGCGCAGCGGACGGCGG - Exonic
1147620666 17:41864791-41864813 GGCGGGAGCGCGGAGGGCGGCGG - Intronic
1147987587 17:44315344-44315366 GGGGCGGGCGGGCCGGGCGGGGG + Intronic
1147994631 17:44354046-44354068 CGCGGGGGCGCGGGCGGCGGCGG + Exonic
1148090264 17:45019101-45019123 GGCGCGGGCGGCCCGGGCGGGGG + Intergenic
1148151099 17:45396778-45396800 AGGGCGGGCGCGGCTGCCGCGGG + Exonic
1148284093 17:46372783-46372805 GGCGCGCGCGCGGCGGGGGCGGG + Intergenic
1148306314 17:46590704-46590726 GGCGCGCGCGCGGCGGGGGCGGG + Exonic
1148782501 17:50129759-50129781 GGCGCGGGCGGGGCTGGACCAGG + Exonic
1150373578 17:64662134-64662156 GGCGGGGGCGCGGGCGGAGGCGG - Intergenic
1150643591 17:66965066-66965088 GCCGCGGGCGCGGCGGGGCGGGG - Exonic
1151537906 17:74749008-74749030 GGCGGGGGACCGGCTGGTGGAGG + Exonic
1151605320 17:75131747-75131769 GGCGCGGGCTCGGCCGGAAGCGG + Exonic
1151662404 17:75525754-75525776 GGAGCGAGCGGGGCCGGCGGCGG + Exonic
1151801809 17:76383537-76383559 GGGGCGGGTGGGGCCGGCGGGGG + Intronic
1152049108 17:77958838-77958860 GGCGGGAGCGCGGCGGGCGCTGG - Intergenic
1152107924 17:78341810-78341832 GGCGCTGGCGCTGCGGGCCGGGG - Intergenic
1152197272 17:78925130-78925152 GGTCCGGGCGCTGCTCGCGGCGG + Exonic
1152321635 17:79611261-79611283 GGCGGCGGCGCGGGCGGCGGTGG + Intergenic
1152333476 17:79686560-79686582 GGCGCTGGCAGGGCTGCCGGGGG + Intergenic
1152362494 17:79839153-79839175 GGCGCGGGGGCGGCGAGCGGCGG - Intronic
1152362554 17:79839388-79839410 GGGGCGGGCGCGGGCAGCGGCGG - Exonic
1152568278 17:81109892-81109914 GGGCCGGGCCCGGCTGGGGGAGG + Intronic
1152686195 17:81694984-81695006 GGCACGGGCGCAGATGGCGTGGG - Exonic
1152738537 17:82009008-82009030 GCAGAGGGCGCGGCTGACGGCGG - Intronic
1152773831 17:82187660-82187682 GGCGCGGGGGAAGCTGGCAGGGG + Intronic
1152834358 17:82519837-82519859 CGCGCGGGCGCCGGTGGCGCGGG - Exonic
1152924220 17:83080059-83080081 TGCGGGGGCGCGGCCGGGGGCGG + Intronic
1152946361 17:83199572-83199594 GGCGTGGGCGAGGCTGCCAGGGG - Intergenic
1153051987 18:908416-908438 GGGGCGCGCGGGGCGGGCGGCGG + Intronic
1153219182 18:2847233-2847255 GGCGCTGGCGCTGCTGGCCCTGG + Exonic
1153451752 18:5238039-5238061 GGCGCGGGGGCGGATCCCGGTGG - Intergenic
1153865534 18:9265058-9265080 GGCGGGAGCGAGGCTGGGGGAGG + Intronic
1153900539 18:9614332-9614354 GGCGGGGGGGAGGCGGGCGGGGG - Intronic
1154070808 18:11149705-11149727 GGCGCGGGAGCCGCGGGTGGGGG - Intergenic
1154181151 18:12141062-12141084 GGCGGCAGCGAGGCTGGCGGAGG - Intergenic
1155054516 18:22171856-22171878 GGAGGCGGCGCGGCTGGCGGCGG + Exonic
1155654574 18:28178008-28178030 GGCGGGGGCGAGGGCGGCGGCGG - Intergenic
1157279027 18:46333939-46333961 CGCGGGCGCGCGGGTGGCGGAGG - Intronic
1157279102 18:46334188-46334210 GGCGCGGGCGCGGGCGGCGGCGG - Intronic
1157353986 18:46917110-46917132 GGCGCGGGGGCGGCGGGCCTGGG - Intronic
1157376986 18:47176148-47176170 GGCGCGGGCTGGGGCGGCGGCGG - Intronic
1157384164 18:47247856-47247878 GGCGCGGGCGCAGGCGGCGCGGG - Intronic
1158427473 18:57352710-57352732 AGCGCGCGCGCGTGTGGCGGAGG - Exonic
1158599858 18:58847702-58847724 GGAGCGGGGGCGGTAGGCGGCGG + Intergenic
1159798032 18:72867585-72867607 GGCGGCGGCGCGGATGGTGGCGG - Exonic
1159947840 18:74457256-74457278 GGCGCGGGCAGGGCTGGCCATGG - Exonic
1160163269 18:76491403-76491425 GGGGCGGGCGGGGCGGGCGGGGG - Intronic
1160204513 18:76822316-76822338 GGCGCGGGCGCGGTGGGGGCGGG - Intergenic
1160630960 18:80246581-80246603 GGCGGGGGCGCGTCCGGAGGTGG + Intronic
1160680339 19:409212-409234 GGCGCGGGCGCGGGCGCGGGCGG - Intergenic
1160719167 19:590012-590034 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1160719181 19:590051-590073 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1160719183 19:590057-590079 GGGGGGGGCGCGGGCGGCGGCGG - Exonic
1160768840 19:821563-821585 GCCGCGGGCGCCGCAGGCCGTGG + Exonic
1160775431 19:853105-853127 GGGGCCGGGGCTGCTGGCGGGGG + Intronic
1160789895 19:918496-918518 GGCGTGGGCGCCACTGGCCGCGG - Intronic
1160810745 19:1012018-1012040 TGCGAGGGCGCGGGTGGGGGCGG - Intronic
1160831926 19:1108284-1108306 GCGGGGGGCGCGGCGGGCGGTGG - Exonic
1160859009 19:1229834-1229856 GGCGCGGGCGGGGAGGGCGGCGG + Exonic
1160860869 19:1236833-1236855 GGCGCGGGGGCGGCGGCCTGGGG + Intronic
1160864103 19:1249598-1249620 GGCGCGGGCGGGGCGGGGGCGGG + Intronic
1160865444 19:1253969-1253991 GGGCCGGGCCGGGCTGGCGGAGG + Intronic
1160867066 19:1260677-1260699 GGCGGAGGGGCGGCAGGCGGAGG + Intronic
1160879467 19:1312961-1312983 GGCGGGTGGGGGGCTGGCGGCGG - Intergenic
1160887518 19:1357695-1357717 GGCGAGGGCGCGTCTGGCACCGG + Intronic
1160909396 19:1467853-1467875 GGCGTGGGCGCGGCCGCCGGGGG - Exonic
1160930591 19:1568006-1568028 GGCGGGGGCGGGGGCGGCGGCGG - Exonic
1160930710 19:1568348-1568370 GGCGGGGCCGCGGGAGGCGGCGG - Intergenic
1160932780 19:1578492-1578514 GGTGCGGAAGCGGCTGGAGGAGG - Exonic
1160934055 19:1584860-1584882 GGCGAGGACGCGGCCCGCGGCGG - Intronic
1160935522 19:1592772-1592794 GGCGCGCGCCCGGCTGGGGGCGG - Intronic
1160947871 19:1652009-1652031 GGCGGGGGCGCGGGGGGCGCCGG - Intronic
1160966621 19:1749571-1749593 TGGGCGGCCGCGGCTGGCCGGGG - Intergenic
1160967714 19:1753870-1753892 GGCGCGGGCAGCGCGGGCGGCGG + Exonic
1161015000 19:1979100-1979122 TGCGCGCGCGCGGCGGGGGGCGG + Intronic
1161072321 19:2269195-2269217 GGGGCGGGGGCGGCTCGCTGGGG - Intronic
1161103884 19:2433929-2433951 GGCACGGGCACGGGTGGCAGCGG - Exonic
1161150108 19:2702875-2702897 GGCGCGGGCGGGGCCGGGGGCGG + Intergenic
1161203693 19:3029363-3029385 GGCGCGGGCGCGGGGAGGGGCGG - Intronic
1161311378 19:3595965-3595987 GGGGCGGGCGGGGCTGGAGGCGG - Intronic
1161323279 19:3651136-3651158 GGCGTGAGCGTGGCAGGCGGAGG - Intronic
1161468756 19:4446165-4446187 CGCTCGGGAGCGGCTGGGGGCGG - Exonic
1161495013 19:4581738-4581760 GCGGCGGCCGCGGCGGGCGGAGG - Intergenic
1161612486 19:5250934-5250956 GGTGCGGGGGCGGCGGGGGGGGG + Intronic
1161664640 19:5568002-5568024 AGCGCGGGCGCGGCGGGGGCGGG - Intergenic
1161702936 19:5804997-5805019 GCCGGGGGCGGGGCTGGGGGCGG - Intergenic
1161977195 19:7613202-7613224 GGGGCGGGGGCGGGTGGGGGCGG + Intronic
1162315535 19:9936263-9936285 GGTGCGGGCGCGGGTGGCTCCGG - Intronic
1162315586 19:9936428-9936450 GGCGGGGTCGCGCCTGGTGGCGG - Exonic
1162524133 19:11197629-11197651 GGCGCCCGGGCGGCTGGAGGGGG - Intronic
1162524235 19:11197901-11197923 GGGGCGGGCGCGGCAGCGGGAGG + Intergenic
1162769997 19:12943658-12943680 GGGGCGGGCAGGGCTGGCAGGGG + Intronic
1162975853 19:14206681-14206703 GGGGGCGGCGCGGCTGGAGGCGG + Intergenic
1163019318 19:14474143-14474165 GGCGCTGGCGCTGCTGGCGCAGG - Exonic
1163051851 19:14690185-14690207 GGGGAGGGCTCGGCTGGCGCGGG + Intronic
1163089716 19:15011232-15011254 CGCGCGGCCGAGGCGGGCGGCGG - Exonic
1163112624 19:15170622-15170644 GGCGGGGGCGGAGCTGGGGGCGG - Intronic
1163320611 19:16572413-16572435 GGCGGGGGCGGGGCTGGGCGGGG + Intronic
1163321534 19:16577532-16577554 GGCGCTGCGGGGGCTGGCGGGGG - Exonic
1163503291 19:17688419-17688441 GGCGGGGGCGCTGCGGGCTGGGG + Intergenic
1163513074 19:17747707-17747729 GGCTGCGGCGCGGCTGCCGGCGG - Exonic
1163527680 19:17831156-17831178 GGCGGGGGCATGGCTGGGGGCGG + Intronic
1163631323 19:18419366-18419388 GGGGCGCGCGCGGCGGGAGGAGG + Exonic
1163655670 19:18543529-18543551 GCGGCGGCCGCGGCTGGGGGCGG - Exonic
1163700884 19:18785938-18785960 GGCGGGGGCGGGGCCTGCGGTGG - Intronic
1164594773 19:29525875-29525897 GGCGGGGGCGGGGCGGGCTGTGG + Intergenic
1164623922 19:29714674-29714696 GGCAGGGGCGGGGCTGGGGGTGG - Intronic
1164693628 19:30227863-30227885 GGCGCGGAGGGGGCCGGCGGAGG + Intergenic
1165058551 19:33194222-33194244 GGCGCTGGCTGGGCGGGCGGAGG - Intronic
1165095555 19:33407928-33407950 GGCCCGGGGGTGGCTGGCTGGGG + Intronic
1165199786 19:34134462-34134484 GGCGTGGCCGCGGCTGGGGTGGG + Intergenic
1165213694 19:34254619-34254641 GGAGCGGGCGCGGCGGGCGCAGG + Intronic
1165461099 19:35944912-35944934 GGGGCGGGCGGGGCGGGCGTGGG - Exonic
1165771978 19:38385446-38385468 GGCGATGGCGTGGCTGGTGGTGG + Exonic
1165803115 19:38565124-38565146 GGCGCGGGCGCGGCGGAGGCGGG + Exonic
1165838007 19:38771067-38771089 GGCGCGCGTGCGCCTGGTGGAGG - Exonic
1165841558 19:38791630-38791652 GGCGCGCGTGCGCCTGGTGGAGG + Exonic
1165850863 19:38849710-38849732 GGAGCCGGGGCGGCGGGCGGCGG - Exonic
1165924862 19:39320752-39320774 GGCCCGGGAGCGGCGGGCGGGGG - Intergenic
1166042900 19:40214005-40214027 GGCGCGGGCGGGGAGGGTGGTGG - Exonic
1166091661 19:40513213-40513235 GGTGCTGGCGCGCCAGGCGGCGG - Exonic
1166199366 19:41226399-41226421 GGCGCGGGGGCTGCGGGCGCGGG + Intronic
1166566098 19:43766659-43766681 GGCTGGGGCGGGGCTGGAGGTGG - Exonic
1166706055 19:44908647-44908669 GGCGCAGGCCCGGCTGGGCGCGG + Exonic
1166714043 19:44955350-44955372 GGACGGGGCGGGGCTGGCGGCGG + Exonic
1166762582 19:45234374-45234396 GCTGCGGGCGCGGCTGCTGGAGG - Intronic
1166888255 19:45973950-45973972 GCGGCGGGCGCGGGCGGCGGCGG + Intergenic
1166888261 19:45973968-45973990 GGCGGCGACGGGGCTGGCGGTGG + Intergenic
1167072730 19:47230410-47230432 GGGGCGGGCGCACGTGGCGGCGG - Intronic
1167080730 19:47274800-47274822 GGCGGGGGCGGGGCCGGAGGCGG + Exonic
1167149729 19:47701828-47701850 CGCTCGGGGGCGGCAGGCGGCGG - Exonic
1167249778 19:48393747-48393769 GCTGCGGGCGAGGGTGGCGGCGG - Intergenic
1167257979 19:48442633-48442655 GGCGGGGGCTTGGCGGGCGGTGG - Exonic
1167369656 19:49072836-49072858 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1167456984 19:49601577-49601599 GGCGAGGGCAGGGCTGGCTGTGG - Exonic
1167457011 19:49601658-49601680 GGCGAGGGCATGGCTGGTGGAGG - Exonic
1167578346 19:50328382-50328404 GAGGCGGGCGCGGGCGGCGGCGG - Exonic
1167638630 19:50668520-50668542 GGCGCGGCCACGGCGGGCGGCGG + Exonic
1167646488 19:50708486-50708508 GGCGAGGGCGGGGTTGGGGGGGG - Intronic
1167994908 19:53394634-53394656 GGCGCGGGCGCGGGAGACTGAGG - Intronic
1168076200 19:53982024-53982046 GGCGGGGGCGGGGCCGGGGGTGG + Intronic
1168076256 19:53982307-53982329 GGCGGGGGCGCGGGCGGCAGTGG + Exonic
1168076384 19:53982733-53982755 GGCGCGGGCGCGGGCGGGGCGGG - Exonic
1168097451 19:54123767-54123789 GGAGCTGGAGCGGCTGGAGGAGG + Exonic
1168315266 19:55482232-55482254 GGCGCGGGGGCGGCGGCGGGAGG - Exonic
1168315344 19:55482511-55482533 GGGGCGGACGGGGGTGGCGGCGG - Exonic
1168694410 19:58396567-58396589 GGCCCGGGCGGGGGCGGCGGCGG - Exonic
1202693209 1_KI270712v1_random:105477-105499 GGCGCAGAGGCGGCCGGCGGCGG + Intergenic
924987755 2:287709-287731 GGCGCTGCTGCGGCTGGTGGTGG - Exonic
925607456 2:5673445-5673467 GGAGCGGCCGCGCCTGGCGGAGG - Intergenic
925959769 2:9003789-9003811 GGCGCGGGAGGAGGTGGCGGCGG - Exonic
926141716 2:10371935-10371957 GGCGCTGGCGGGCCTGGAGGAGG - Intronic
926154888 2:10448264-10448286 GGCGCCGGAGCTGCTGGCAGAGG + Exonic
926301907 2:11610928-11610950 CGTGCGGGCCCGGCTGGCGCTGG + Exonic
926422950 2:12716873-12716895 GTCGCGGGGGCGGCGGGGGGGGG + Exonic
927596632 2:24403170-24403192 GGGGCGAGCGCGGGGGGCGGGGG - Intergenic
927652440 2:24920456-24920478 GGCGCGGGCGCGGGCGTGGGCGG + Intergenic
927713678 2:25340491-25340513 GGCGCGGACCGGGCTGGCGCGGG - Intronic
927751418 2:25673590-25673612 GGCGCGAGGGCGGAGGGCGGAGG + Exonic
927904818 2:26848633-26848655 GGCGGGGGCGCCTCTGGCCGGGG + Intronic
927943272 2:27118923-27118945 GGCCCGGGGGAGGCTGGCGGCGG - Exonic
928412601 2:31066402-31066424 GGTGCGGGGGCGGGGGGCGGGGG + Intronic
928904815 2:36356942-36356964 GGTGGGGGCGCCGCGGGCGGGGG + Intronic
929936410 2:46297324-46297346 GGGGCGGGCGCGGAGGGCGGGGG - Intronic
930700671 2:54456254-54456276 GGCGGGAGCGCGGGGGGCGGGGG - Intergenic
931321445 2:61177612-61177634 GGCGCTGGCGCGGCTGGCGGCGG + Exonic
931671760 2:64653989-64654011 GGCCGGGGCGGGGCCGGCGGGGG - Intronic
932699581 2:73984258-73984280 GGCGCGGGGGAGGCTGGTGATGG + Intergenic
932700020 2:73985514-73985536 GCGGCGGGCGCGGCGGGCGCGGG + Intergenic
932716205 2:74101945-74101967 GGCACGGGCACGGCAGGAGGAGG + Exonic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
932780120 2:74554321-74554343 GGCTCGGGCGGGGCTGGGGGCGG + Exonic
933684729 2:85133748-85133770 AGCGCCGGGGCGGCCGGCGGAGG + Exonic
933810090 2:86027744-86027766 GGAGCGGGGGCGGCTGGAGGGGG - Intronic
933909893 2:86930322-86930344 GGCGCGGAGGCGGGGGGCGGGGG + Intronic
934022833 2:87973066-87973088 GGCGCGGAGGCGGGGGGCGGGGG - Intergenic
934079023 2:88452180-88452202 GAGGCGGGCGCGGCGGGCGCGGG + Exonic
934761890 2:96861120-96861142 GGGGCTGGTGTGGCTGGCGGTGG - Exonic
934993183 2:98935856-98935878 GGCGCGGGGGCACCGGGCGGAGG - Intronic
935592545 2:104855583-104855605 GACGCGGCAGGGGCTGGCGGCGG + Exonic
935592552 2:104855598-104855620 GGCGGCGGCGGGGGTGGCGGCGG + Exonic
935731019 2:106065280-106065302 GGCGCGGCTGGGGCGGGCGGAGG + Intronic
937045285 2:118848018-118848040 GGTGCGGGCGCGGGTGGGGGAGG - Intergenic
937221747 2:120346071-120346093 GGCGCGGGCGCGGGCGGGGGCGG + Intergenic
937221811 2:120346288-120346310 GGCGGCGGCGCGGCAGGCGTCGG - Exonic
937395445 2:121530619-121530641 CGCCGGGGCGGGGCTGGCGGGGG - Intronic
937624195 2:124025214-124025236 GGGGCGGGCCTGGCTGGGGGCGG + Intergenic
938258356 2:129877773-129877795 GGGGCGGGCGCGCGTGTCGGGGG + Intergenic
938258370 2:129877812-129877834 GGGGCGGGCGCGCGTGTCGGGGG + Intergenic
939470391 2:142613374-142613396 GGCGGCGGCGAGGCTGGGGGAGG - Intergenic
939990892 2:148875945-148875967 GGGCCGGGCGGGGGTGGCGGGGG + Intronic
940401877 2:153257040-153257062 GGCGGCAGCGAGGCTGGCGGAGG - Intergenic
940774994 2:157876029-157876051 GGGGCCGGCGCGGCTGGCCGAGG + Intergenic
940883490 2:158969130-158969152 CGAGCGGGCGCGCCGGGCGGGGG - Intronic
940883529 2:158969217-158969239 GGCGCGGGGGAGGCGGGGGGAGG + Intronic
941020971 2:160407661-160407683 CGCGCGGCGGCGGCCGGCGGGGG + Intronic
941367083 2:164621743-164621765 GGCCCCGGCGCCGCTGGAGGCGG + Exonic
941772764 2:169362184-169362206 GGCGCGGGAGCTGCTCCCGGTGG - Intronic
941804275 2:169694591-169694613 GGCGCCGGGGCGGCTGCCGACGG + Exonic
941978934 2:171434149-171434171 GGCGGGGCCGCGGCAGGCAGAGG + Intronic
942398882 2:175580515-175580537 GGCGGGGGCGCGGTGGGGGGCGG + Intergenic
942748718 2:179264615-179264637 GGAGCGGGCCCGGGCGGCGGCGG + Exonic
943185179 2:184598361-184598383 GGCGCGGCCGCGGGTCCCGGCGG + Exonic
944515694 2:200509924-200509946 GCCGCGGGCCCGGAAGGCGGCGG - Exonic
945225916 2:207530588-207530610 GCCGGGGGCGAGGCGGGCGGCGG - Intronic
945305468 2:208255145-208255167 GTCGGGGGCGGGGCTGGGGGAGG - Intronic
945585225 2:211653459-211653481 GGGGCGGGTGCGGGGGGCGGGGG - Intronic
945699393 2:213151668-213151690 TGCGCGAGCCCGGCCGGCGGGGG - Intronic
946029073 2:216690898-216690920 GGGGCGGGGGCGGTGGGCGGAGG + Intronic
946875565 2:224126220-224126242 GCCGAGGGCGTGGCTGGCTGAGG + Intergenic
947523355 2:230864839-230864861 GGCGCAGGCGCGGCGGGCGCCGG + Intronic
947549807 2:231037954-231037976 GGGACGTGCGCGGCCGGCGGCGG + Exonic
947717887 2:232351047-232351069 GGACCGGTCGCGGCGGGCGGCGG - Intergenic
947724158 2:232387208-232387230 GGCCCGGTCGCGGCCGGCGGCGG - Intergenic
947729351 2:232419551-232419573 GGCCCGGTCGCGGCGGGCGGCGG - Intergenic
947741335 2:232486376-232486398 GGCCCGGTCGCGGCCGGCGGCGG - Exonic
947741754 2:232487907-232487929 GGGGCGCGCGGGGCGGGCGGAGG - Intergenic
948075593 2:235163043-235163065 GGCGGGGGTGCTGGTGGCGGGGG + Intergenic
948115983 2:235494521-235494543 GGCGCGGGCGGAGCAGGCGCGGG - Exonic
948248687 2:236507625-236507647 GGCGCAGGCGCGGAATGCGGGGG - Intergenic
948402198 2:237692252-237692274 GGCTCGGGCGCGGCCGACAGGGG - Intronic
948420902 2:237859551-237859573 GGCGCGGGAGCGGTGGGAGGCGG - Exonic
948426929 2:237894449-237894471 GGCCAGGGCGAGGCTGGCTGTGG + Intronic
948492145 2:238320568-238320590 GGCGGCGGCGGGGCCGGCGGCGG + Exonic
948560411 2:238847924-238847946 GGGGCGGGGGCGGCCGGCGAAGG + Intergenic
948645383 2:239400892-239400914 GGCTCGGGCTCGGGCGGCGGCGG + Exonic
948780537 2:240319077-240319099 GGAGGGGGCGAGGCTGGAGGAGG + Intergenic
948874811 2:240820669-240820691 GGGGCGGGCGGGGCTGGGGAGGG + Intergenic
949040091 2:241844064-241844086 GGCGCGGGCGTGGGTGGAGCTGG + Intergenic
1168777742 20:462264-462286 GGGGCAGGGGCAGCTGGCGGAGG - Intronic
1168804321 20:663591-663613 GGCGAGGGCGCTGCGGGCGCAGG + Exonic
1168965090 20:1894253-1894275 CGCGGGGGCGCGGGGGGCGGGGG - Exonic
1169065640 20:2692999-2693021 GGCGCTGGCGCTGGCGGCGGCGG + Exonic
1170890040 20:20368700-20368722 GGCGCGAGCGGAGCTGGCGGAGG + Exonic
1171849814 20:30300408-30300430 GACCCGGGCGGGGCGGGCGGCGG - Intergenic
1171865484 20:30485394-30485416 GGCGCGGCCCCGGCTGGCCGGGG + Intergenic
1171972479 20:31573016-31573038 GGCCAGGGCGCGGGAGGCGGAGG + Intronic
1172284622 20:33732097-33732119 TGCGAGGGCGCGGCGGGAGGGGG - Intronic
1172408210 20:34704562-34704584 GGCCCGGGCGCGGGGGGCGCAGG - Intronic
1172428597 20:34872806-34872828 GGCGCGGGCGAGGATGGCGGCGG - Exonic
1172618743 20:36306518-36306540 GGCGCGGGGGTGGCGCGCGGCGG + Intronic
1172644477 20:36461388-36461410 GACGCGCGCGCGGCTGACGCGGG + Intronic
1172696891 20:36829137-36829159 GAAACGGGCGCGGCTGGAGGAGG - Exonic
1173210750 20:41029494-41029516 GGCGCGGGGGAGGCGGCCGGCGG - Intronic
1173221587 20:41136927-41136949 GGCGGGGGCGGGGCTGCCTGCGG - Intergenic
1173279730 20:41617971-41617993 GCCGCGGGCCTGGCGGGCGGGGG - Intronic
1173752376 20:45487484-45487506 GGTGGGGCAGCGGCTGGCGGGGG - Intergenic
1173880257 20:46406504-46406526 GGTCGGGGCGCGGCAGGCGGTGG - Intronic
1174576737 20:51542536-51542558 AGGGCGGGCGCGGCTGGCTCTGG + Exonic
1174607027 20:51768443-51768465 GGCGCGGCGCCGGCGGGCGGCGG - Exonic
1175215319 20:57389380-57389402 GGCGCGGGCGAGGCGGGCCCGGG + Intergenic
1175215818 20:57391321-57391343 GGGGCGGGGCCGGCTGGGGGCGG + Intergenic
1175267091 20:57709616-57709638 GGCTCGGGGGCGGCCGGGGGGGG + Exonic
1175847123 20:62065041-62065063 GGCGAGGGCGCGGCGGGCGCGGG + Exonic
1175902939 20:62367128-62367150 GGCGCGGGCGCGGGAGGAGGCGG - Exonic
1176005791 20:62861695-62861717 GGCGAGGGCGACGCGGGCGGCGG + Exonic
1176005841 20:62861871-62861893 GGAGGGGGCGGGGCTGGCGCAGG - Intergenic
1176005854 20:62861902-62861924 GGCGGGGGCGGGGCCGGCGGCGG - Intergenic
1176039472 20:63056636-63056658 GGGGCTGGCGGGGCTGGCAGTGG + Intergenic
1176194427 20:63830891-63830913 GGCGCGGGCTCCGGGGGCGGCGG - Intronic
1176194568 20:63831292-63831314 CGCGCGCGCGCGGGCGGCGGGGG - Intergenic
1176221073 20:63969658-63969680 GGCGCCGGCGCGGGGCGCGGGGG + Intronic
1176221083 20:63969679-63969701 GGCTCGGGCGCGGCGGGGGGCGG + Intronic
1176223179 20:63979559-63979581 GGCGCGGGGCCGGCTGGGGCGGG - Exonic
1176380702 21:6111031-6111053 GGCGGGGGCGGGGCAGGGGGCGG + Intergenic
1176548441 21:8211807-8211829 GGCGCGGGGGCGGTTCTCGGCGG + Intergenic
1176556333 21:8256013-8256035 GGCGCGGGGGCGGTTCTCGGCGG + Intergenic
1176567372 21:8394842-8394864 GGCGCGGGGGCGGTTCTCGGCGG + Intergenic
1176567850 21:8396340-8396362 GGCGCGGGAGCGGCGGTCGGCGG - Intergenic
1176575272 21:8439055-8439077 GGCGCGGGGGCGGTTCTCGGCGG + Intergenic
1176619158 21:9043157-9043179 GGCGCAGTCGCGGGGGGCGGGGG - Intergenic
1177188116 21:17819675-17819697 GGGGCGGGGGCCGCAGGCGGCGG + Intergenic
1177431689 21:20998267-20998289 GGCGGGGGCGCGGCGAGGGGAGG - Intergenic
1178400182 21:32278801-32278823 GGAGAGGGCGCAGCTGGAGGAGG - Exonic
1178922488 21:36747786-36747808 GGACGGGGCGCGGCTGGCGCTGG + Exonic
1178954740 21:37012031-37012053 GACGCTGGGGCGGGTGGCGGAGG - Intronic
1178992283 21:37366399-37366421 GGCGCGGGCGCGGGGCGGGGCGG + Intronic
1179209345 21:39312940-39312962 GGCGCGGGGGGGGCGGGGGGCGG + Intronic
1179457315 21:41508258-41508280 GGGGCGGGGGCGGCGGGAGGAGG + Intronic
1179674812 21:42974367-42974389 GGTGCGGGCGGGGCTGGAGGCGG + Intergenic
1179674953 21:42974839-42974861 GGAGGGGGCGCGGGTGGGGGAGG + Intronic
1179742770 21:43427209-43427231 GGCGGGGGCGGGGCAGGGGGCGG - Intergenic
1179788211 21:43741355-43741377 GGCTCGCGGGGGGCTGGCGGGGG + Intronic
1179902578 21:44401707-44401729 GGCACGGGCGCGGGCCGCGGGGG - Exonic
1180070250 21:45432242-45432264 GGCTGGGGCTGGGCTGGCGGAGG + Intronic
1180097099 21:45560895-45560917 GGCGCTCTCACGGCTGGCGGAGG + Intergenic
1180110085 21:45643475-45643497 GGCGGGGGTGGGGCTGGGGGCGG - Intergenic
1180110134 21:45643613-45643635 GGCGGGGGCGGGGCCGGCGGCGG + Intergenic
1180622519 22:17171600-17171622 GGCCCGGGCGCGGCCGGCAGGGG + Intergenic
1180831093 22:18906486-18906508 TACGCGGGCGGGGCGGGCGGCGG + Intronic
1180949410 22:19714455-19714477 CGCGCGGGCGGAGCGGGCGGCGG + Exonic
1180959239 22:19755249-19755271 ACCGCGGGCGGGGGTGGCGGGGG - Intergenic
1181000892 22:19987282-19987304 GGGGTGGGCGTGGCGGGCGGGGG + Intronic
1181094397 22:20495766-20495788 AGTGCGGCCTCGGCTGGCGGCGG - Exonic
1181168094 22:20993998-20994020 GGCGCGGGAGAGGCTGGCCCAGG + Exonic
1181632029 22:24156394-24156416 CGCGCGGGGGCGGCAGGCGCTGG + Intronic
1181745470 22:24952743-24952765 GGCGCGGCGCGGGCTGGCGGTGG + Intronic
1181787643 22:25238400-25238422 GGCGGGGGCGGGGCGGGGGGTGG + Intergenic
1181813708 22:25421132-25421154 GGTTGGGGCGCGGCGGGCGGCGG + Intergenic
1181831669 22:25564954-25564976 GGTCGGGGCGCGGCGGGCGGCGG + Exonic
1182355267 22:29719955-29719977 GGCGGGCGGGCGGCTGGCGGGGG + Intergenic
1182355468 22:29720604-29720626 GGCGCGGGGGCGGGGGGCGGGGG + Intronic
1182442813 22:30374027-30374049 GGAGCGGGAGCGGCTGCTGGTGG + Exonic
1183149744 22:36028416-36028438 GGGGCGCGGGCGGATGGCGGAGG - Exonic
1183437699 22:37804973-37804995 GTGGCGGGCGCGGGGGGCGGCGG + Intergenic
1183486398 22:38089481-38089503 GGCGGGGGCGCGAACGGCGGCGG + Intronic
1183649445 22:39145655-39145677 TGCGTGCGCGCGGCCGGCGGGGG - Intronic
1183744813 22:39686212-39686234 GGCGTGGGGGCGGCCGGGGGCGG - Exonic
1183929436 22:41227646-41227668 GGAGAGGGCGGGGCTGGAGGAGG - Intronic
1184046712 22:41976721-41976743 GGCGCGGGCGCCGCGGGAAGGGG + Intronic
1184046736 22:41976792-41976814 GCAGCGGCGGCGGCTGGCGGCGG + Exonic
1184101390 22:42343446-42343468 AGCGCGGGCGCGGCGGGGGGCGG - Intronic
1184276478 22:43411946-43411968 GGCGCGCGGGCGGGCGGCGGAGG + Intronic
1184523860 22:45010066-45010088 GGCGCGGGCGGGGCGGGGGCGGG - Intergenic
1184602974 22:45554388-45554410 GGCACGGGTGCTGCTGGCGGTGG - Intronic
1184653745 22:45931071-45931093 GGTGCGGGTGCGGCTGGTGGGGG - Intronic
1184712791 22:46262994-46263016 AGCGCGGGCGCGGCCGGCCAGGG + Exonic
1184766864 22:46576836-46576858 GGCGTGGCCGTGGCCGGCGGCGG + Intronic
1184767038 22:46577406-46577428 GGCTCGGGCCCGGGCGGCGGCGG - Intronic
1185037910 22:48489392-48489414 GGCGCGGGGTCGGCGGGCGCGGG + Intergenic
1185037915 22:48489413-48489435 GGCGCGAGCGCGGGCGGCGCGGG + Intergenic
1185038203 22:48490351-48490373 GGCGCGGGCGCGGGCTGGGGTGG + Intronic
1185055286 22:48575918-48575940 GGAGCGAGCGCGGGCGGCGGAGG + Intronic
1185229289 22:49670989-49671011 GGCGTGGGTGGGGCTGGAGGGGG - Intergenic
1185255207 22:49827769-49827791 GGCGCGGGCGCGGGAGCGGGCGG + Intergenic
1185313626 22:50169875-50169897 GGCGCGGCCGGGGCAGGTGGGGG + Intergenic
1185387783 22:50544245-50544267 GGGGCCGGCGGGGCTGGCGCTGG + Intergenic
1185398543 22:50604548-50604570 GCGGCGGGCGCGGGCGGCGGCGG - Exonic
1185409409 22:50674358-50674380 GGGGCGGGGGCGGCGGGGGGAGG - Intergenic
1185420240 22:50730887-50730909 GGGGCGGGCGCGGGGGGCGCAGG + Intergenic
1203253323 22_KI270733v1_random:128110-128132 GGCGCGGGGGCGGTTCTCGGCGG + Intergenic
1203261378 22_KI270733v1_random:173189-173211 GGCGCGGGGGCGGTTCTCGGCGG + Intergenic
1203281180 22_KI270734v1_random:131757-131779 TACGCGGGCGGGGCGGGCGGCGG + Intergenic
949461965 3:4303497-4303519 GGCGCCGGCGCGGCCCCCGGGGG - Exonic
949509833 3:4758337-4758359 GGAGCGGGCATGGCTTGCGGGGG - Intronic
949987526 3:9552700-9552722 GCGGCGGCGGCGGCTGGCGGGGG + Exonic
950269808 3:11605030-11605052 GGCGGGGGCGTGGCGGGCGATGG - Intronic
950730093 3:14948587-14948609 GGCGGGGGCGGGGCCGGGGGCGG + Intronic
951954700 3:28241589-28241611 GGCGCAGGCGCAACGGGCGGCGG + Exonic
952706192 3:36380403-36380425 GCCGCGGGCGCGGCGGGGCGGGG + Exonic
952866959 3:37861329-37861351 GGCGCGGGAAGTGCTGGCGGAGG - Intergenic
953326106 3:42013712-42013734 GGCCCCGGGGCGGCGGGCGGGGG - Intergenic
953404656 3:42654471-42654493 GCCTCGGGCGCGGCGGGCGGGGG - Intronic
953614481 3:44477752-44477774 GGCTCCGGTGCGGCGGGCGGCGG + Intergenic
954148667 3:48646856-48646878 GGCTCTGGCGGGGCTGGTGGGGG + Exonic
954397334 3:50299657-50299679 GCCTGGGGCGGGGCTGGCGGAGG - Intergenic
954540836 3:51392114-51392136 GGCGCGGGCGGCCCTGGGGGAGG - Exonic
959256830 3:104025778-104025800 GGCGGGGGCGCGGGTGGTGGGGG + Intergenic
960223767 3:115146985-115147007 GGCGCGGGCGGGGCGGGGCGGGG + Intronic
961354986 3:126331974-126331996 GGCGCCAGCGAGGCTGGGGGAGG + Intergenic
961446214 3:126982996-126983018 GGCGGGGGCGGGGCCGGCGGCGG - Intergenic
961827526 3:129606757-129606779 GGGTCGGGGGCGGCTGGCGCGGG - Exonic
962222348 3:133574174-133574196 GCCGCGGGTGCGGCGGGCGGCGG + Exonic
962318637 3:134374016-134374038 GGCGGGGGTGGGGGTGGCGGGGG - Intronic
963236728 3:142963630-142963652 GGCGGCGGCGCGGCTGACTGCGG + Exonic
963252993 3:143119666-143119688 GGCGGGGGCGGGGCCGGCGAAGG + Exonic
964107209 3:153052128-153052150 GGCTCTGCCTCGGCTGGCGGAGG - Intergenic
964118930 3:153162503-153162525 GGCGCCGGGCCGGCCGGCGGCGG - Exonic
964201226 3:154121395-154121417 GGCGCCGGCGCCGCGGTCGGCGG + Intronic
966182155 3:177197368-177197390 GGGGCGCACGCGGCCGGCGGCGG + Intronic
966362765 3:179148299-179148321 GGGGCGGGGGCGTGTGGCGGGGG + Intronic
966372173 3:179261457-179261479 GGCTCGGGCGCAGCCGGCAGGGG + Intronic
966411769 3:179652893-179652915 GGCGCGGCGGCGGGGGGCGGAGG - Exonic
966860628 3:184229549-184229571 GGCGCGGGCCCTGCCGGCGGTGG - Intronic
966866539 3:184261504-184261526 GGGGCGGGGGCGGGGGGCGGGGG + Intronic
966915793 3:184583594-184583616 GGCCCTGGCACAGCTGGCGGCGG + Intronic
967171795 3:186827569-186827591 TGCGCGAGCGCGGCGGGCGGAGG + Intergenic
967858522 3:194135127-194135149 GGCGTGGGCGCGCCTGGAGCCGG - Intergenic
968043841 3:195612435-195612457 TGCGGGGGCGGGGCTGGAGGAGG + Intergenic
968235850 3:197029703-197029725 GGCGCCGTCGGGGCTGGCTGGGG + Exonic
968433821 4:575199-575221 GGGGCCGGCGGGGCCGGCGGGGG - Intergenic
968479239 4:826339-826361 GGGGCGGGGGCGGGGGGCGGGGG + Intergenic
968479293 4:826424-826446 GGGGCGGGGGCGGGGGGCGGGGG + Intergenic
968515002 4:1012093-1012115 GGCGGGGGCGGGGCAGGCCGGGG - Intronic
968603066 4:1519506-1519528 GGCCTGGGGGCGGCTGGAGGGGG + Intergenic
968603379 4:1520728-1520750 GGCCTGGGCGGGGCTGGAGGGGG - Intergenic
968603418 4:1520810-1520832 GGCCTGGGCGGGGCTGGAGGGGG - Intergenic
968603438 4:1520851-1520873 GGCCTGGGCGGGGCTGGAGGGGG - Intergenic
968653076 4:1767567-1767589 GTCGGGGGCGGGGCCGGCGGGGG + Intergenic
968660022 4:1794998-1795020 ACCGCGGGCGCGGCGGGCCGGGG + Intronic
968701057 4:2058648-2058670 TGCGCGGCCGCGGGGGGCGGGGG + Intergenic
968701370 4:2059632-2059654 GGCCCGGGCGCGGCGGGCAGCGG - Exonic
968764815 4:2462747-2462769 GCGGCGGGCGCGGGAGGCGGTGG + Intronic
968775399 4:2536866-2536888 GGCGCGGGGGCCGCGGGCGGCGG - Intronic
968820195 4:2844096-2844118 GCCGCGGTTGCGGCGGGCGGGGG + Intronic
969115499 4:4868474-4868496 TGCGCGGGGGCGGGTGGGGGGGG - Intergenic
969344886 4:6564126-6564148 CGCGCGGTGACGGCTGGCGGAGG - Intergenic
969578305 4:8049063-8049085 GGCCCGGGCCCAGCTGGCAGTGG - Intronic
969582093 4:8071538-8071560 GGCGAGGGCTCGGCTGGCAGTGG + Intronic
969618996 4:8269656-8269678 GGCCTGGGCGGGGCTGGCGGAGG + Intergenic
969689380 4:8695875-8695897 GGGGCGGGCAGGGCAGGCGGGGG + Intergenic
969691575 4:8706903-8706925 GGCCCCGGCGGGGCTGGAGGAGG - Intergenic
969873175 4:10116984-10117006 GGCGGGGCCGGGGCCGGCGGGGG - Intergenic
971019075 4:22516115-22516137 GGGGCGGGGGCGGCCGCCGGCGG - Intergenic
971279989 4:25234571-25234593 GGTGCGGCTGCGGCTGGCGCCGG - Intronic
972418811 4:38867885-38867907 AGCGCGGGGGCGGCTGCCCGGGG + Intronic
974002993 4:56530019-56530041 GGAGCGGGGGCGGGGGGCGGGGG - Intergenic
975118418 4:70704673-70704695 GGGGCGGGAGGGGCTGGAGGAGG + Intronic
976199171 4:82562038-82562060 GGCCCCGGCGCGGCAGGAGGGGG - Intronic
976569707 4:86594275-86594297 GGAGCCGGCGCGGCTGCCCGAGG + Intergenic
978072562 4:104491405-104491427 GGCGGGGGCGGGGGTGGTGGGGG - Exonic
978072590 4:104491459-104491481 GGCGGGGGCGGGGGCGGCGGCGG - Exonic
978532636 4:109730136-109730158 GGCGGGGGCGGGGTTGGGGGGGG + Intergenic
980053795 4:128061534-128061556 TGCGCGGCCTCGGCGGGCGGCGG + Intronic
980930114 4:139176866-139176888 GGCGGGGGCGCGGAGGGAGGCGG + Intronic
981128401 4:141132621-141132643 GGGGCCGGGGCGGCGGGCGGCGG - Exonic
981366663 4:143912135-143912157 GGCGCCGGCGGAGGTGGCGGCGG - Intergenic
981429888 4:144646232-144646254 GGCGGCGGCGGGGCAGGCGGAGG - Exonic
984206481 4:176792810-176792832 GGCGGCGGGGCGGCTGGCGGCGG + Intergenic
985068430 4:186144940-186144962 GGCGCGGGCGCGGGCGCGGGCGG + Exonic
985068434 4:186144946-186144968 GGCGCGGGCGCGGGCGGGTGGGG + Exonic
985241747 4:187937791-187937813 GGCGCGGGGGCGTGTGGCGCGGG - Intergenic
985713947 5:1445537-1445559 GGCGGGGGCGCGGCCCGGGGAGG - Intergenic
985896140 5:2751074-2751096 GGCTCGGGTTCGGCGGGCGGGGG - Intronic
985995647 5:3595721-3595743 GGGGCGGGAGCGGCCGGCGAGGG + Intergenic
987050774 5:14144810-14144832 GACGCGGGCCCGGCTCGCGCGGG - Intronic
987088162 5:14488103-14488125 GGAGCCGGGTCGGCTGGCGGGGG - Exonic
987108703 5:14664882-14664904 GACGCCGGCGCGGGAGGCGGCGG + Exonic
987132585 5:14872324-14872346 GGCGGTGGCCGGGCTGGCGGCGG + Intergenic
987303421 5:16617011-16617033 CGCGCGGGCGCGCCTGGGTGTGG + Exonic
989744286 5:44809320-44809342 GGCTCGGGCTCCGCTGGGGGCGG - Exonic
990825456 5:59893423-59893445 GGCTGGGGCGAGGGTGGCGGCGG + Exonic
990955120 5:61332702-61332724 GGCGGCGGCGCGGGCGGCGGCGG + Exonic
990955122 5:61332708-61332730 GGCGCGGGCGGCGGCGGCGGCGG + Exonic
991474405 5:67004246-67004268 GGCGCGGCCGGGGCTGGTGGGGG + Intronic
991587317 5:68214940-68214962 GTCGGGGGCGGGGTTGGCGGGGG - Intergenic
992067402 5:73120507-73120529 TGCGCGGGCGCGGCGGCCCGGGG - Exonic
992105719 5:73448025-73448047 GGCGGCGGCGCGGGCGGCGGCGG - Exonic
992663608 5:78984901-78984923 GGCGGGGGCGGCGCGGGCGGCGG + Intronic
995188617 5:109297532-109297554 GGCGGGGGCGGGGATGGGGGCGG + Intergenic
996443038 5:123512703-123512725 GCCGCAGGCGCGGGTGTCGGGGG + Intronic
997265128 5:132490842-132490864 GGCGCCCGCGCGGCTGTCCGGGG - Intergenic
997470582 5:134114925-134114947 GGCGGGGGCGGCGCGGGCGGCGG + Exonic
998018838 5:138753366-138753388 GGGGCGGGGGCCGCGGGCGGGGG + Intronic
998200474 5:140114272-140114294 GGCGGGGGCGGTGGTGGCGGCGG + Exonic
998366658 5:141636839-141636861 GGCCGGGGAGGGGCTGGCGGCGG - Exonic
998374479 5:141681952-141681974 GGCGGGGGCGGGGCGGGCAGTGG + Intronic
998435960 5:142108983-142109005 GGCGTTGGCGGCGCTGGCGGCGG + Exonic
998568923 5:143239844-143239866 GGCGGGGGCGGGGGTGGGGGTGG - Intergenic
998903220 5:146877864-146877886 GGCGGGGGCTCGGCTGGCCCCGG - Intronic
999129447 5:149271798-149271820 GGCGCGGGCGCGGGCGGGGCGGG + Intergenic
999129471 5:149271904-149271926 GGCTCCGGCGCGGCTGGTAGCGG - Exonic
999188817 5:149731520-149731542 GAACCGGGCGCGGCTCGCGGGGG + Intronic
999989137 5:157033573-157033595 GGGGCGGGGGCGGGTGGGGGTGG + Intronic
1001065081 5:168529598-168529620 GGCGCGGGCAAGGGCGGCGGGGG + Exonic
1001529882 5:172454380-172454402 AGCGCGGGTGCGGGTGGCGCGGG + Exonic
1001563209 5:172683586-172683608 GCCGCGGCGTCGGCTGGCGGTGG - Exonic
1001586005 5:172834311-172834333 GGCGGGGGCGGGGCGGCCGGAGG + Exonic
1001653260 5:173329786-173329808 GGCGCGGGCGGGGCGCGGGGCGG - Intergenic
1001666240 5:173435754-173435776 GGCGCGGGTGCGGCGGGAGCTGG - Intergenic
1002048174 5:176553711-176553733 GGTGGTGGCGGGGCTGGCGGTGG - Intronic
1002158957 5:177303749-177303771 GGCGCGGGCGCCGGAAGCGGTGG + Intronic
1002180054 5:177426676-177426698 GGAGAGTGCGCGGCTGGCTGCGG + Intronic
1002352053 5:178590166-178590188 GGCGAGCGCGCCGGTGGCGGCGG - Exonic
1002401726 5:178994875-178994897 GCCGCTGGCGTGGCTGGCGCAGG - Exonic
1002487740 5:179550935-179550957 GGCGCGGGCGCGGTGGGGGCCGG + Intronic
1002559374 5:180071424-180071446 GGCCCGGGGGCGGCGGGCGGTGG - Intronic
1002632685 5:180591545-180591567 AGCGCGGGCGAGGCCGGCGCTGG - Intergenic
1002691376 5:181053011-181053033 GGCGGGGGCGCGCGCGGCGGAGG - Intronic
1002898003 6:1390185-1390207 GGCGCGGGCGCCGGGAGCGGGGG + Exonic
1002926697 6:1609461-1609483 GGCGTCGGCGGGGCTGGCGAAGG + Intergenic
1004193968 6:13487695-13487717 GGGGCGGGGGCGGCGCGCGGCGG - Intergenic
1004561804 6:16759968-16759990 TGCGCGCGCGCGCCGGGCGGGGG - Intronic
1004562088 6:16760907-16760929 GGCGCGGGCGGGGAGAGCGGCGG - Intronic
1004562123 6:16760985-16761007 GGCGCAGGGGCGGCCGGCGGGGG - Intronic
1005040445 6:21595580-21595602 GGCGGGCGAGCGGCCGGCGGCGG - Exonic
1005421129 6:25652244-25652266 GACGCGAGCGCTGCTGGCCGTGG - Exonic
1006089619 6:31620774-31620796 GGGGCGGGGGAGGATGGCGGCGG - Exonic
1006180723 6:32151960-32151982 GGGGCGGGGGGGGCGGGCGGAGG + Intronic
1006369135 6:33633598-33633620 CCCCCGGGCGCGTCTGGCGGAGG + Intronic
1006611648 6:35297828-35297850 GGCGCCCGCCCGGCTGGGGGCGG - Intergenic
1006860767 6:37170374-37170396 GGCGCTGCCGGGACTGGCGGCGG - Exonic
1006860911 6:37170900-37170922 GGGGAGGGCGCGCCGGGCGGGGG + Intronic
1007367691 6:41406427-41406449 GGCGGGCACGCGGCTGGAGGAGG + Intergenic
1007390181 6:41546342-41546364 CGCGCGGGCGGGGCGGGAGGGGG - Intergenic
1007465548 6:42048859-42048881 GGGGCGGGGGCTGCGGGCGGGGG - Intronic
1007553163 6:42745707-42745729 GGCGCTGGCGCGGCTGCAGGCGG - Exonic
1007739500 6:44002258-44002280 GGCGTGGGCGCGGGCGGCGGGGG - Intronic
1008554749 6:52664158-52664180 GCTGCGGGCTCGGCGGGCGGAGG + Intergenic
1008915780 6:56785424-56785446 GGCGGCAGCGAGGCTGGCGGAGG - Intronic
1010083063 6:71886620-71886642 GGCGGGGGCGGGGCTGGGGCTGG - Intergenic
1011195134 6:84773405-84773427 GGCGCGGGCTGGGCTGGAGCCGG - Intergenic
1011244444 6:85307456-85307478 GGCGGCGGCGAGGCTGGGGGAGG + Intergenic
1012450549 6:99349469-99349491 GGCGCGGGCGGCGCGGGCGGCGG + Exonic
1013099459 6:106974821-106974843 GGCGGGGAGGCGGCGGGCGGCGG - Intronic
1013117560 6:107114723-107114745 GGCGCGAGTGGGGCGGGCGGCGG + Intronic
1013170830 6:107635080-107635102 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1014098271 6:117482900-117482922 GGAGCGCGTCCGGCTGGCGGCGG + Intronic
1014137544 6:117907200-117907222 GGCGGGGGCGCCGGCGGCGGCGG - Intergenic
1014137741 6:117907916-117907938 GGCGAGGGCGCGGGGGGCGGGGG + Intronic
1014632503 6:123803781-123803803 GGCGAGCGCGCGTCGGGCGGCGG + Intergenic
1015244730 6:131063200-131063222 GAGGCAGGCGCGGCTGCCGGCGG - Exonic
1015315018 6:131807940-131807962 GGGGCGGGCGCGGCGGGGAGGGG + Intergenic
1015625828 6:135180864-135180886 GTCGCGGGGGCGGCAAGCGGTGG - Intergenic
1015773536 6:136792261-136792283 GGCGAGGGCGCGGCGCGCGATGG - Exonic
1016340914 6:143060807-143060829 GGCGCGGGCGCGGGGCGGGGCGG - Intronic
1016433145 6:144008434-144008456 GGCGCTGGGGCCCCTGGCGGGGG + Intronic
1016923331 6:149317431-149317453 GGCGGGGGAGCAGCAGGCGGCGG - Intronic
1016923476 6:149317894-149317916 GGCGGCGGCGGCGCTGGCGGCGG + Intronic
1017672282 6:156778842-156778864 GGCGCGGGCGGCGGCGGCGGCGG + Exonic
1018612713 6:165660961-165660983 GTCGCGGTCGCGGATGGAGGGGG - Intronic
1018686534 6:166308102-166308124 GGGGCGGGGGCGGGCGGCGGCGG + Exonic
1019054404 6:169213168-169213190 CGCGCGGGCGGGGCTCGCCGGGG + Intergenic
1019109974 6:169702036-169702058 GGCGTGGGCGCGAGGGGCGGCGG - Intronic
1019184141 6:170211226-170211248 GGGGCAGACGCGGCTGGCGGTGG - Intergenic
1019283136 7:210559-210581 GCCGCGGGCACGGCTGGGGGAGG + Intronic
1019343584 7:519517-519539 GGCGAGCGCGGGGCCGGCGGTGG - Intronic
1019474374 7:1236837-1236859 GGCGACGGCGCGGGCGGCGGGGG - Exonic
1019719447 7:2559395-2559417 GGCGCGGGCGAGGCTGCAGGCGG - Intronic
1019828351 7:3301678-3301700 GGGGCGGGCGCGGCCGGGCGGGG - Exonic
1020014921 7:4825244-4825266 GGAACGGGCGCAGCTGGCTGAGG + Intronic
1020034988 7:4959221-4959243 GGCGGGGGCGGGGCGGGCGGGGG + Intergenic
1020281788 7:6653562-6653584 GGCGGGGCCGCGGGCGGCGGAGG + Exonic
1021313146 7:19117050-19117072 GGCGGCGGCGCGGGCGGCGGCGG - Exonic
1021452781 7:20798069-20798091 GCCGCGGGCGCGGGAGGCGGAGG + Intergenic
1021744248 7:23722795-23722817 GGCGGCGGCGAGGCTGGGGGAGG - Intronic
1021828061 7:24573796-24573818 CGCGCGGGCCGGGCTGGGGGCGG - Intronic
1021969364 7:25951382-25951404 GGCGGGGGCGGGGTGGGCGGTGG + Intergenic
1021969379 7:25951419-25951441 GGCGGGGGCGCGGCCGGCGCTGG + Intergenic
1021998337 7:26201635-26201657 GGCGCGCGCCCGGCGGGGGGAGG - Intronic
1022091414 7:27110279-27110301 GGCGGGGGCGCGGCAGGGGTAGG + Exonic
1022207702 7:28180087-28180109 GCGGAGGGCGCGGCGGGCGGCGG - Intronic
1022207767 7:28180264-28180286 GGAGCGGGCTCGGGTGGGGGAGG - Intronic
1022706884 7:32810256-32810278 GGCAGGGGCGCTGCTGGCTGCGG - Intergenic
1022715146 7:32891882-32891904 GGCGGGGGCGGGGGCGGCGGGGG - Exonic
1023064849 7:36367036-36367058 GGCGGGGGCGCGGCGGGAGGCGG + Intronic
1023937110 7:44748370-44748392 GGCGCGGGCGGGGCGGGTGGGGG + Intergenic
1023937267 7:44748872-44748894 CGCGATGGCGCGGGTGGCGGCGG + Intronic
1023955725 7:44885371-44885393 GGCGCGAGCGCGGCGGGCGGTGG - Intergenic
1024065281 7:45727144-45727166 CGCCCGGGCGCGGCCGCCGGAGG + Intergenic
1024520948 7:50304035-50304057 GGTGCGCGCGGGGGTGGCGGCGG + Intergenic
1025916838 7:65873119-65873141 CGCGCGGGCGCGGAGGGAGGGGG - Intergenic
1026360871 7:69599744-69599766 GGGGCCGGCGCGGCCGGCGGCGG + Exonic
1026806929 7:73434566-73434588 GGCCCGGGCGCGGGCGGCAGTGG + Exonic
1026909404 7:74083736-74083758 GGGGCGCGGGCGGCCGGCGGCGG - Intronic
1028252829 7:88556627-88556649 GGCGGCGGCGAGGCTGGGGGAGG - Intergenic
1028871095 7:95772509-95772531 GGCGCGGGCGTGGAGGGCGTGGG + Intronic
1028984055 7:96996210-96996232 GGCGGGGGCGGGGTTGGGGGTGG + Intergenic
1029238818 7:99144105-99144127 GGCGCGCGCGCGGCTCGGAGAGG - Intergenic
1029535268 7:101154321-101154343 AGCGCGGGCGGGGCTGGAGGCGG - Intergenic
1029537095 7:101163300-101163322 GGAGCGGGGGCGGGGGGCGGGGG + Exonic
1029640408 7:101816414-101816436 GGCGGCGGCGGCGCTGGCGGCGG - Intronic
1029640668 7:101817127-101817149 GGTGCGGGCGCGGGAGGAGGAGG + Intronic
1029708318 7:102286794-102286816 GGCGGGGCCGGGGCTCGCGGCGG + Intronic
1029715144 7:102321581-102321603 GGCGCGCGCGCGGCCGGGCGCGG - Exonic
1030138767 7:106284741-106284763 GGGGCGGGGGCGGCTGGGGCTGG - Intronic
1030216012 7:107044643-107044665 GGCGCGGCCGCGGCTGGAGCGGG + Exonic
1031043553 7:116862926-116862948 GGCGCGGGCGCGGGGGAGGGCGG + Intronic
1031052070 7:116954167-116954189 GGCCCGAGGGCGGCTGCCGGAGG + Intronic
1032087541 7:128891703-128891725 GGCAGGGGCGAGGCTGGCAGTGG + Exonic
1032230629 7:130070692-130070714 GCCGCCGGCGCTGGTGGCGGAGG + Exonic
1033299641 7:140175767-140175789 GCTGCGGGGCCGGCTGGCGGCGG - Intronic
1033361287 7:140640582-140640604 GGCTCGGGGGCGGGCGGCGGCGG + Exonic
1033369739 7:140697143-140697165 GGCGCGGGCGGTCCAGGCGGAGG + Intronic
1033589384 7:142797185-142797207 GGCGCGGGCGCGGGCGGCTTGGG + Intergenic
1034455499 7:151167812-151167834 GGCGCGGCGGCGGCGGGCGGAGG - Intronic
1034911704 7:155003077-155003099 GGCGGGGGCGCGGAGGGCGGGGG - Exonic
1034959838 7:155358336-155358358 GGCGAGGGAGAGGCTGGGGGAGG + Exonic
1035169565 7:157010037-157010059 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1035212102 7:157336534-157336556 GGCGCGGGCGCGGGCGCGGGCGG - Intronic
1035266102 7:157691006-157691028 GGCGCGCACCCGGCCGGCGGCGG + Intronic
1035404287 7:158587901-158587923 GGGGCGAGCGGGGCTGGCCGGGG - Intergenic
1035900698 8:3456019-3456041 GGCGGCGGCGAGGCTGGGGGAGG - Intronic
1037260441 8:17001874-17001896 GGAGCGCGCGCGGCGGGCCGGGG - Exonic
1037450797 8:19014005-19014027 GGCGGGCGCGCGGCTGCGGGAGG - Intronic
1037928978 8:22865972-22865994 AGCGCTGGCGCGGCCGGCTGGGG - Intronic
1038311757 8:26450211-26450233 GGCGGGCGCGCGGCTAGCTGGGG + Intronic
1038650818 8:29401769-29401791 GGCGGGGGGGCGGGGGGCGGCGG - Intergenic
1038761264 8:30385220-30385242 GGCGCGGGCCCGGGGCGCGGCGG + Intronic
1039996749 8:42541307-42541329 GGCGCCGGCGGGGCTCGCGGCGG - Intronic
1040951147 8:52940000-52940022 GCTGCCGGCGCCGCTGGCGGTGG + Exonic
1041690150 8:60679653-60679675 GGGGCGGGGGCGGGAGGCGGGGG - Intronic
1041792668 8:61714436-61714458 GACGCGGGAACCGCTGGCGGCGG + Exonic
1042785087 8:72537365-72537387 GCCGCGGGGGCGGAGGGCGGAGG - Intergenic
1042962670 8:74320760-74320782 GGCGCGGGCGCGGGGGTGGGAGG + Intronic
1043388146 8:79768003-79768025 GGGGCGGGCGCGGAGGGCGGGGG - Intergenic
1043463954 8:80486952-80486974 AGCGCGGGCGGCGCTGGCGGCGG - Exonic
1043502948 8:80874269-80874291 GGCGCGGCGGCCGCGGGCGGGGG + Intronic
1045327281 8:101126649-101126671 CGGGCGGGGGCGGCTGGGGGCGG - Intergenic
1045432192 8:102124330-102124352 GAGGGGGGCGCGGCTGGCGACGG - Intronic
1045488542 8:102653894-102653916 GGGGCGGGGGCGGACGGCGGGGG + Intronic
1045489101 8:102655763-102655785 GCCGCGGGCGGGGGTGGGGGCGG + Exonic
1045535299 8:103021628-103021650 GGGGGGGGCGCGGGTGTCGGGGG + Intronic
1045607035 8:103788859-103788881 GGCGGCGGCGAGGCTGGGGGAGG - Intronic
1045674089 8:104589054-104589076 GGAGCGCGCGCGGGCGGCGGCGG - Intergenic
1047124779 8:121948344-121948366 GGGGCGGGGGCGGGGGGCGGTGG - Intergenic
1048214136 8:132480489-132480511 GCGGCGGGGGCGGCTGGCGGCGG - Exonic
1049197978 8:141325817-141325839 GGCGGGGGTGGGGGTGGCGGGGG + Intergenic
1049476134 8:142797743-142797765 AGAGAGGGCGCGGCTGTCGGAGG + Intergenic
1049585296 8:143430153-143430175 GGCGGCGGCGCGGGGGGCGGCGG - Exonic
1049620936 8:143598006-143598028 GGCCCGGGCGCGGGGGGCGGCGG - Exonic
1049659964 8:143815508-143815530 GACGCGGCCGCGGCCGGCGCTGG + Intergenic
1049682485 8:143925836-143925858 GGAGCGCGAGCGGCTGGCCGAGG - Exonic
1049685878 8:143939166-143939188 GGCGCCCGCGAGGCTGACGGGGG - Intronic
1049686739 8:143942158-143942180 GGAGGGGGCGGGGCTGGAGGGGG - Intronic
1049707730 8:144050652-144050674 GGCGCGTGCCCAGCCGGCGGGGG - Intergenic
1049803110 8:144527245-144527267 GCCGCGAGCGCGGGTGGCGCGGG + Exonic
1049807441 8:144547402-144547424 GGCGCAGGCTCGGCTGGCCTGGG - Exonic
1049879445 8:145052251-145052273 GGCGCGGGCGGGGCGGGGAGCGG - Intergenic
1049879458 8:145052278-145052300 GGCGCGGGCGGGGCGGGGCGCGG - Intergenic
1050744120 9:8857661-8857683 GGCGCGGGAGGCGGTGGCGGCGG - Intronic
1050744122 9:8857667-8857689 GGCGGCGGCGCGGGAGGCGGTGG - Intronic
1050873983 9:10612911-10612933 GCTGCGGGCGCGGCTGGGCGGGG + Intergenic
1051894600 9:21974725-21974747 GGTGCGGGCGCTGCTGGAGGCGG - Exonic
1053306154 9:36986133-36986155 GGCGCGGGCGCGGCGGCAGCCGG - Intronic
1053690457 9:40584306-40584328 GGCGGCGGCGAGGCGGGCGGCGG - Intergenic
1053690463 9:40584324-40584346 GGCGGCGGCGAGGCGGGCGGCGG - Intergenic
1054274320 9:63053073-63053095 GGCGGAGGCGAGGCGGGCGGCGG + Intergenic
1054274341 9:63053143-63053165 GGCGGCGGCGAGGCGGGCGGCGG + Intergenic
1054301705 9:63385249-63385271 GGCGGCGGCGAGGCGGGCGGCGG - Intergenic
1054400482 9:64711785-64711807 GGCGGCGGCGAGGCGGGCGGCGG - Intergenic
1054400488 9:64711803-64711825 GGCGGCGGCGAGGCGGGCGGCGG - Intergenic
1054434068 9:65196029-65196051 GGCGGCGGCGCGGCGGGCGGCGG - Intergenic
1054434074 9:65196047-65196069 GGCGGCGGCGCGGCGGGCGGCGG - Intergenic
1054434080 9:65196065-65196087 GGCGGCGGCGAGGCGGGCGGCGG - Intergenic
1054434086 9:65196083-65196105 GGCGGCGGCGAGGCGGGCGGCGG - Intergenic
1054434092 9:65196101-65196123 GGCGGAGGCGAGGCGGGCGGCGG - Intergenic
1054434101 9:65196130-65196152 GGCGGAGGCGAGGCGGGCGGCGG - Intergenic
1054434110 9:65196159-65196181 GGCGGAGGCGAGGCGGGCGGCGG - Intergenic
1054496290 9:65825555-65825577 GGCGGAGGCGAGGCGGGCGGCGG + Intergenic
1054496299 9:65825584-65825606 GGCGGAGGCGAGGCGGGCGGCGG + Intergenic
1054496305 9:65825602-65825624 GGCGGCGGCGAGGCGGGCGGCGG + Intergenic
1054496311 9:65825620-65825642 GGCGGCGGCGAGGCGGGCGGCGG + Intergenic
1054496317 9:65825638-65825660 GGCGGCGGCGAGGCGGGCGGCGG + Intergenic
1054886491 9:70204644-70204666 GGCGCCAGCGAGGCTGGGGGAGG - Intronic
1055611808 9:78031693-78031715 GGAGCGGGCGCGCCGGGCGCGGG - Intergenic
1055945716 9:81689507-81689529 GGCGCGGGCGGCGGCGGCGGTGG - Intergenic
1055945815 9:81689841-81689863 CGGGAGGACGCGGCTGGCGGAGG - Intergenic
1056799474 9:89681371-89681393 GGGGCGGGGGCGGCCGCCGGGGG - Intergenic
1057245606 9:93451881-93451903 GGCGCGGGCGCGGGTGCGGGCGG - Exonic
1057869706 9:98708673-98708695 CGCGCGGGCGGCGGTGGCGGCGG + Exonic
1058058546 9:100473235-100473257 GGCGCGCGCGCGGCGGGCGGGGG - Exonic
1058436499 9:104968546-104968568 CGCGCATGCGCGGCTGCCGGAGG + Intergenic
1058686904 9:107488140-107488162 GGAGCCGGTGCGGCTTGCGGCGG - Exonic
1058687336 9:107489949-107489971 GGCGCGGGCGGGGCTGGGCCGGG + Intronic
1059061396 9:111038251-111038273 GGGCCGGGCTCGGCTGGCGGTGG - Intronic
1059375137 9:113875901-113875923 GGAGCGGGCGCGGGGGGCGCGGG + Intergenic
1059440993 9:114306708-114306730 GGGGTGGGTGCGCCTGGCGGTGG + Intronic
1060661728 9:125408580-125408602 GCCGTGGGCGCGGCCGGCAGGGG + Intergenic
1060811080 9:126611849-126611871 GGCGGGGGCGCGGCTGCTGCAGG - Intergenic
1060825110 9:126683297-126683319 GCCGCGGGCCGGGCGGGCGGCGG - Intronic
1061061004 9:128250554-128250576 GGCGTTGGCGCCGCTGGGGGCGG + Intronic
1061212674 9:129202922-129202944 GGCCCGGGCGGGGCGGGCGCTGG - Intergenic
1061317112 9:129803245-129803267 GGCGCTGGCGCTGCTGCTGGCGG + Exonic
1061472156 9:130835304-130835326 GGCGCGGGCGCGCGGGGCGGCGG + Intronic
1061540779 9:131277099-131277121 GGGGCGGGCGCGGGGGGCGGGGG - Intergenic
1061580217 9:131531559-131531581 GGCCCGGGGGCGGCCGGGGGAGG - Intergenic
1061799407 9:133105807-133105829 GGGGCTGGGGCGGCGGGCGGTGG - Intronic
1061853273 9:133428570-133428592 GGCGGGGGCGGGGGTGGGGGCGG - Intronic
1062230517 9:135479578-135479600 GGCGCGGGCGCGGCGGCAGGTGG + Intronic
1062341192 9:136094689-136094711 GGCGCGGGCCCGGCTGGGCCAGG + Intronic
1062361970 9:136192703-136192725 AGCGGGGGCGGGGCTGGGGGTGG - Intergenic
1062364366 9:136201987-136202009 GTCGCGGGCGCGGCGCGGGGTGG - Intronic
1062365226 9:136205164-136205186 CGCGCGGGCGGGGCGGGCAGCGG - Intergenic
1062461898 9:136665765-136665787 GGCGCGGGCTCGGGCGGCAGTGG + Intronic
1062533853 9:137013076-137013098 GGGGCGGGCGAGGGTGGGGGTGG + Exonic
1062561971 9:137145695-137145717 GGCGGGGGCACGGCGGGCTGAGG - Intronic
1062574562 9:137200215-137200237 GGCGCGGGCGGCGGCGGCGGCGG + Exonic
1062596497 9:137302145-137302167 GGCGCGCGCTCGGCTCGCGGGGG + Exonic
1062659096 9:137619075-137619097 GGCGCGGGGGCGGCGGGCAGCGG + Intronic
1062676753 9:137750760-137750782 GGAGGGGGCGCGGCTGCCGGAGG + Intronic
1203469723 Un_GL000220v1:111257-111279 GGCGCGGGGGCGGTTCTCGGCGG + Intergenic
1203477544 Un_GL000220v1:155229-155251 GGCGCGGGGGCGGTTCTCGGCGG + Intergenic
1203360684 Un_KI270442v1:217714-217736 GGCGCGGCCCCGGCTGGCTGAGG + Intergenic
1185471604 X:387000-387022 GGGGCGCGCGTGGCTAGCGGCGG - Intergenic
1186355385 X:8784271-8784293 TGCCCGGGCCCCGCTGGCGGTGG + Intergenic
1186973326 X:14873231-14873253 GGCGATCTCGCGGCTGGCGGGGG + Intergenic
1187154622 X:16712020-16712042 GGCGCTGGCGCGGGCGGAGGCGG + Exonic
1187155880 X:16719965-16719987 GGCGCGGGCCCGACTGGCTGGGG + Intronic
1187826192 X:23334810-23334832 GGCGCGGGTTCGGGCGGCGGCGG - Exonic
1188242614 X:27809435-27809457 GGGGCGGGCGGGGTTGGGGGGGG - Intronic
1188242638 X:27809474-27809496 GGCGGGGGGGGGGCCGGCGGGGG - Intronic
1188242644 X:27809485-27809507 GGGGCGGGCGGGGCGGGGGGGGG - Intronic
1188242663 X:27809510-27809532 GGCGGGGGGGGGGCGGGCGGGGG - Intronic
1189002875 X:36963969-36963991 GCCGCGGGAGCCGCGGGCGGGGG - Intergenic
1189337149 X:40176810-40176832 GGTGGCGGCGCAGCTGGCGGGGG - Intronic
1190024607 X:46912343-46912365 AGGGCGAGCGCGGCCGGCGGTGG + Intronic
1190285188 X:48957080-48957102 GGGGTTGGCGCGGTTGGCGGGGG - Exonic
1190546891 X:51537156-51537178 GGCGGCAGCGCGGCTGGGGGAGG - Intergenic
1190984423 X:55488521-55488543 GGTGGGGGCGGGGGTGGCGGCGG + Exonic
1190984435 X:55488545-55488567 GGCGGGGGCCGGGCTGGAGGCGG + Exonic
1191830015 X:65406698-65406720 GGCGCGGGCGGCGGCGGCGGCGG + Intronic
1192251417 X:69417003-69417025 GGGGCGGGGGCGGCAGGGGGAGG - Intergenic
1193085997 X:77448142-77448164 GGGGCGGGGGCGCCTTGCGGTGG + Intronic
1194698931 X:97090396-97090418 GGCCCGGGCGTGGCGGGCAGCGG - Intronic
1195442088 X:104909941-104909963 GGCGTCAGCGAGGCTGGCGGAGG - Intronic
1196001986 X:110795956-110795978 GGCGCGGGCGCGGCGGCCCGGGG + Intergenic
1197873549 X:131082393-131082415 GGCGCGGGGGCGGCGGCAGGAGG + Intronic
1197991465 X:132322724-132322746 GGCGGGGGCGGGGGTGGCGTGGG - Intergenic
1198205321 X:134460092-134460114 CGCGCGGGCGGGGCCGGGGGCGG + Intergenic
1198254724 X:134914941-134914963 GGGCCGGGCGCCGCGGGCGGCGG + Intronic
1198388046 X:136147405-136147427 GGGGCGGGCGCGGCTAGCCAGGG - Exonic
1198832340 X:140764353-140764375 GGCGGGGGCGGGGGTGGGGGTGG + Intergenic
1199612710 X:149631666-149631688 AGCGTGGACGCGGCTGGCGCTGG - Exonic