ID: 919750148

View in Genome Browser
Species Human (GRCh38)
Location 1:201032593-201032615
Sequence CAGGGTGTGCAAAGGGTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919750138_919750148 27 Left 919750138 1:201032543-201032565 CCTGTGCAAGAGGGAGTTGTTGA No data
Right 919750148 1:201032593-201032615 CAGGGTGTGCAAAGGGTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919750148 Original CRISPR CAGGGTGTGCAAAGGGTTTC AGG Intergenic
No off target data available for this crispr