ID: 919751341

View in Genome Browser
Species Human (GRCh38)
Location 1:201040060-201040082
Sequence GCTCTGGTTCGAGGGGGCCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 146}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919751341_919751354 5 Left 919751341 1:201040060-201040082 CCCAGGCCCCCTCGAACCAGAGC 0: 1
1: 0
2: 0
3: 4
4: 146
Right 919751354 1:201040088-201040110 GGGAGGAGAGTAGGCTGAGTGGG 0: 1
1: 0
2: 4
3: 50
4: 509
919751341_919751355 6 Left 919751341 1:201040060-201040082 CCCAGGCCCCCTCGAACCAGAGC 0: 1
1: 0
2: 0
3: 4
4: 146
Right 919751355 1:201040089-201040111 GGAGGAGAGTAGGCTGAGTGGGG 0: 1
1: 1
2: 7
3: 67
4: 588
919751341_919751356 15 Left 919751341 1:201040060-201040082 CCCAGGCCCCCTCGAACCAGAGC 0: 1
1: 0
2: 0
3: 4
4: 146
Right 919751356 1:201040098-201040120 TAGGCTGAGTGGGGTCTTCCTGG 0: 1
1: 0
2: 1
3: 14
4: 190
919751341_919751358 17 Left 919751341 1:201040060-201040082 CCCAGGCCCCCTCGAACCAGAGC 0: 1
1: 0
2: 0
3: 4
4: 146
Right 919751358 1:201040100-201040122 GGCTGAGTGGGGTCTTCCTGGGG 0: 1
1: 0
2: 3
3: 37
4: 264
919751341_919751351 -4 Left 919751341 1:201040060-201040082 CCCAGGCCCCCTCGAACCAGAGC 0: 1
1: 0
2: 0
3: 4
4: 146
Right 919751351 1:201040079-201040101 GAGCCTGCAGGGAGGAGAGTAGG 0: 1
1: 0
2: 2
3: 97
4: 1162
919751341_919751360 30 Left 919751341 1:201040060-201040082 CCCAGGCCCCCTCGAACCAGAGC 0: 1
1: 0
2: 0
3: 4
4: 146
Right 919751360 1:201040113-201040135 CTTCCTGGGGAGCCACATTTGGG 0: 1
1: 0
2: 0
3: 12
4: 168
919751341_919751357 16 Left 919751341 1:201040060-201040082 CCCAGGCCCCCTCGAACCAGAGC 0: 1
1: 0
2: 0
3: 4
4: 146
Right 919751357 1:201040099-201040121 AGGCTGAGTGGGGTCTTCCTGGG 0: 1
1: 0
2: 0
3: 30
4: 224
919751341_919751359 29 Left 919751341 1:201040060-201040082 CCCAGGCCCCCTCGAACCAGAGC 0: 1
1: 0
2: 0
3: 4
4: 146
Right 919751359 1:201040112-201040134 TCTTCCTGGGGAGCCACATTTGG 0: 1
1: 0
2: 0
3: 12
4: 152
919751341_919751353 4 Left 919751341 1:201040060-201040082 CCCAGGCCCCCTCGAACCAGAGC 0: 1
1: 0
2: 0
3: 4
4: 146
Right 919751353 1:201040087-201040109 AGGGAGGAGAGTAGGCTGAGTGG 0: 1
1: 1
2: 7
3: 67
4: 797

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919751341 Original CRISPR GCTCTGGTTCGAGGGGGCCT GGG (reversed) Exonic