ID: 919752796

View in Genome Browser
Species Human (GRCh38)
Location 1:201048699-201048721
Sequence GCAGTGGCCTGCCGCTGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 217}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919752792_919752796 1 Left 919752792 1:201048675-201048697 CCACCAGCCGCTGTACAGGGAGA 0: 1
1: 0
2: 0
3: 9
4: 120
Right 919752796 1:201048699-201048721 GCAGTGGCCTGCCGCTGAGCTGG 0: 1
1: 0
2: 0
3: 22
4: 217
919752793_919752796 -2 Left 919752793 1:201048678-201048700 CCAGCCGCTGTACAGGGAGACGC 0: 1
1: 0
2: 0
3: 2
4: 65
Right 919752796 1:201048699-201048721 GCAGTGGCCTGCCGCTGAGCTGG 0: 1
1: 0
2: 0
3: 22
4: 217
919752791_919752796 2 Left 919752791 1:201048674-201048696 CCCACCAGCCGCTGTACAGGGAG 0: 1
1: 0
2: 1
3: 5
4: 117
Right 919752796 1:201048699-201048721 GCAGTGGCCTGCCGCTGAGCTGG 0: 1
1: 0
2: 0
3: 22
4: 217
919752794_919752796 -6 Left 919752794 1:201048682-201048704 CCGCTGTACAGGGAGACGCAGTG 0: 1
1: 0
2: 0
3: 6
4: 120
Right 919752796 1:201048699-201048721 GCAGTGGCCTGCCGCTGAGCTGG 0: 1
1: 0
2: 0
3: 22
4: 217
919752788_919752796 29 Left 919752788 1:201048647-201048669 CCGTCGCTGTTCAGGGGCATGTT 0: 1
1: 1
2: 2
3: 10
4: 108
Right 919752796 1:201048699-201048721 GCAGTGGCCTGCCGCTGAGCTGG 0: 1
1: 0
2: 0
3: 22
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919752796 Original CRISPR GCAGTGGCCTGCCGCTGAGC TGG Intronic
900151094 1:1179708-1179730 GCAGTGGCCTGGTGCAGGGCAGG - Exonic
900599278 1:3496195-3496217 GCAGTGGCCTGGCCCCCAGCAGG - Intronic
901711763 1:11121234-11121256 CCAGTGGCCTACCTCGGAGCTGG + Exonic
901828740 1:11879458-11879480 GCAGGGGCCAGCTGCTGTGCAGG + Intergenic
902676007 1:18009079-18009101 GCTGTGGCCTGCCTGTGAGCTGG - Intergenic
903027302 1:20438511-20438533 GCAGTGGCTTCCAGCAGAGCAGG - Intergenic
905175699 1:36134138-36134160 GCAGTGGCCGGCGGCTGTCCTGG + Intergenic
905443905 1:38012453-38012475 GCACTGGCCTCCGTCTGAGCTGG - Intronic
905530276 1:38672986-38673008 GCAGTGGCCTCCCGAAGTGCTGG - Intergenic
907462938 1:54616035-54616057 GCAGTGGCTGGACGCTGTGCTGG - Exonic
908527394 1:65001336-65001358 GCAGAGGCCTCCTGCGGAGCTGG + Intergenic
908539828 1:65111801-65111823 GCAGTGTCCTGAGGCTGAGCAGG + Intergenic
911267291 1:95757038-95757060 ACAGTTGCCTGCCACAGAGCTGG + Intergenic
912554366 1:110505451-110505473 ACAGCTGCCTCCCGCTGAGCAGG - Intergenic
912615690 1:111097493-111097515 GCAGTGCCCTGAGGCTGTGCAGG + Intergenic
914349961 1:146832224-146832246 GGAGTGGCCTGGCCATGAGCGGG - Intergenic
914748368 1:150515638-150515660 GCTGTGCCCCGCCCCTGAGCCGG + Intergenic
914952807 1:152132124-152132146 GCAGTGACCTGGCACTGGGCAGG - Intergenic
916653183 1:166849610-166849632 GCAGTGTCCTGGCTCTGCGCAGG + Exonic
918323086 1:183383234-183383256 GCAGTGTCCTGAGGCTGTGCAGG + Intronic
919752796 1:201048699-201048721 GCAGTGGCCTGCCGCTGAGCTGG + Intronic
920136975 1:203777854-203777876 GCCGTGGCCTCCCACAGAGCTGG - Intergenic
924463932 1:244283668-244283690 GCAGAGGGCTGCCTCTGAGTCGG - Intergenic
1063417832 10:5888896-5888918 GGAGGTCCCTGCCGCTGAGCAGG + Intronic
1065140216 10:22713493-22713515 GCATCGCCCTGCCGCTGTGCGGG - Intronic
1065244336 10:23742272-23742294 GGAGGGGCCTGCCACTGAGCAGG + Intronic
1067806220 10:49395277-49395299 GCAGCCGCCTGCCGGTGAGTAGG - Intronic
1068198082 10:53744833-53744855 GCAGTGTCCTGATGCTGTGCAGG + Intergenic
1069638592 10:69940758-69940780 GCAGTGGCTGGCTGCTGAGCAGG - Intronic
1070349973 10:75582500-75582522 GCAGTGTCCTGAGGCTGGGCAGG + Intronic
1070581587 10:77724585-77724607 GCAGTGTCCTGAAGCTGTGCAGG - Intergenic
1073082388 10:100868370-100868392 GCATTGGCAAGCCCCTGAGCTGG + Intergenic
1073952732 10:108829499-108829521 GCAGTGTCCTGAGGCTGCGCAGG + Intergenic
1076426222 10:130369492-130369514 CTAGTGGCCTGCTGCTGTGCAGG - Intergenic
1076825192 10:132963651-132963673 GGAGCGGCCTGGGGCTGAGCAGG - Intergenic
1077800427 11:5530711-5530733 GCACTGGCCTGGCTCTGGGCTGG + Intronic
1078388908 11:10917943-10917965 GCAGTGTTCTGAGGCTGAGCAGG + Intergenic
1079431029 11:20388161-20388183 GCAGAGGCCAGGCGCTGAGGCGG - Intronic
1080875141 11:36267962-36267984 GCAGAGGCCATCCCCTGAGCTGG + Intergenic
1082862401 11:57868598-57868620 GCAGTGTCCTGAGGCTGAGCAGG + Intergenic
1083458023 11:62791919-62791941 GCAGGGGCCGGCAGGTGAGCAGG + Exonic
1084121499 11:67071641-67071663 GCGCTGACCTGCTGCTGAGCTGG + Exonic
1084558516 11:69889564-69889586 CCAGTGGCCTGTCTCAGAGCTGG - Intergenic
1085086601 11:73672019-73672041 GCAGTGTCCTGAGGCTGTGCAGG + Intergenic
1085145418 11:74191626-74191648 GCAGAGTCCTGAGGCTGAGCAGG - Intronic
1085396777 11:76210432-76210454 GCAGCGGGCAGCCGCTCAGCGGG - Intronic
1088614178 11:111606862-111606884 GCATTGGCCTCCCACTGTGCTGG - Intronic
1089315815 11:117590583-117590605 GCAGGGACCTGGCTCTGAGCAGG - Intronic
1089494405 11:118901066-118901088 GCAGAGGCATGTGGCTGAGCCGG + Exonic
1089752384 11:120660882-120660904 GCTGTGGCCTGGCTCTGAGAGGG + Intronic
1091152598 11:133342716-133342738 GGAGTCTCCTGCAGCTGAGCTGG + Intronic
1091640762 12:2235370-2235392 GCAGTGCCCAGCAGCTGAGCTGG - Intronic
1092347932 12:7731614-7731636 GCAGAGGCCTCTGGCTGAGCAGG + Intronic
1093775456 12:23068532-23068554 GCACTGTCCTGCCACAGAGCAGG + Intergenic
1096581173 12:52586270-52586292 GCAGTGGCTTCCTGCTGAGATGG + Intronic
1097042521 12:56164306-56164328 GCAGTGGGCTGGCACTGGGCAGG + Exonic
1099984640 12:89648828-89648850 GCAGTCTCCTGAAGCTGAGCAGG - Intronic
1101917595 12:108907944-108907966 GCATTGGCCTGCCCTTTAGCAGG - Intergenic
1104169389 12:126265384-126265406 GCCATGGTCTGCCTCTGAGCAGG + Intergenic
1104666898 12:130653894-130653916 GCAGTGTCCTGAAGCTGTGCAGG + Intronic
1104771945 12:131369157-131369179 ACAGTGGCCTGCTGCTCACCTGG - Intergenic
1104964542 12:132503021-132503043 GCTGTGGCCTGGCCCTGTGCGGG - Intronic
1106502315 13:30340632-30340654 GCCGGGGCCTGCCACTTAGCTGG + Intergenic
1110411186 13:75205160-75205182 GCAGTGTCCTGAGGCTGTGCAGG + Intergenic
1112929148 13:104713580-104713602 GCAGTGTCCTGATGCTGAGCAGG + Intergenic
1113437786 13:110306997-110307019 GCAGCAGCCAGACGCTGAGCCGG + Exonic
1118691410 14:68344016-68344038 GCAGTAGCCTGCTGCAGAGGTGG + Intronic
1119596134 14:75935816-75935838 GCAGCTGCCTGCCTCTGAGATGG + Intronic
1119601167 14:75978345-75978367 GCAGTGGGCAGGTGCTGAGCAGG - Intronic
1119649561 14:76374080-76374102 GCAGCGGCCTGTCACTCAGCAGG + Intronic
1119875068 14:78052366-78052388 GCAGAGGCCTACCACTGAGTAGG + Intergenic
1121570807 14:94945244-94945266 GCAGTGGCCTGCGGCACAGCAGG + Intergenic
1121796627 14:96741469-96741491 ACAGTGGGGTGCCGCGGAGCCGG - Intergenic
1122602367 14:102928180-102928202 CCAGTGTCCTGTCCCTGAGCTGG - Intronic
1123098240 14:105776477-105776499 GCAGGGCCCTGGGGCTGAGCAGG + Intergenic
1127691902 15:61404810-61404832 GCAATGGGCTGCAGGTGAGCTGG - Intergenic
1129606852 15:77029188-77029210 GAAGTGGCCTGAGGGTGAGCTGG + Intronic
1132660343 16:1058229-1058251 GCAGAGGCCGGACACTGAGCAGG - Intergenic
1136723664 16:32341502-32341524 GCAGTGGTCTGCCCCTGGTCTGG - Intergenic
1139984077 16:70883307-70883329 GGAGTGGCCTGGCCATGAGCGGG + Intronic
1140943818 16:79748951-79748973 GCAGTGGGATGCTGCTGGGCAGG - Intergenic
1141360462 16:83390926-83390948 GCAGAGGCCTGGCTCTTAGCAGG + Intronic
1141577837 16:84976088-84976110 GCCGTGGCCTCCTGCAGAGCTGG - Intronic
1141707994 16:85679842-85679864 GCAGTGGCCAGCCCCTGGGAGGG - Intronic
1142105409 16:88299800-88299822 GGAGTTGCCTGACCCTGAGCAGG + Intergenic
1203002767 16_KI270728v1_random:176263-176285 GCAGTGGTCTGCCCCTGGTCTGG + Intergenic
1203134373 16_KI270728v1_random:1712669-1712691 GCAGTGGTCTGCCCCTGGTCTGG + Intergenic
1143140604 17:4739939-4739961 GGCGTGGCCGCCCGCTGAGCCGG + Intergenic
1144206899 17:12985795-12985817 GCAGTAGCATGGCGGTGAGCTGG + Intronic
1145046631 17:19622785-19622807 GCAGCTGCCTGCCGCGGAACTGG + Intergenic
1146812387 17:35914398-35914420 ACTGTGGCCTCCTGCTGAGCTGG + Intergenic
1147606692 17:41777684-41777706 GCTGTGGCCTGAGGATGAGCTGG + Intronic
1148382297 17:47208969-47208991 GCAGTGGGCTGCCTCTGCTCGGG + Intronic
1148924335 17:51069985-51070007 GCAGTGGCATGCACCTGAGGTGG + Intronic
1150295215 17:64003775-64003797 GCTGTGGCCTCCTGCGGAGCAGG + Exonic
1150787711 17:68176206-68176228 GCAGGGACCAGCCACTGAGCTGG + Intergenic
1150963554 17:69940884-69940906 GCAGTGTCCTGAGGCTGTGCAGG - Intergenic
1151828776 17:76537896-76537918 GCCGTGGCCTGCGGGTGGGCGGG - Exonic
1152073414 17:78145173-78145195 GCAGTGGCCCACAGCGGAGCTGG + Intergenic
1152343491 17:79737974-79737996 GGAGGGGCCTGCTGCTGGGCGGG - Exonic
1152601876 17:81266758-81266780 GCAGTGCCTTCCTGCTGAGCAGG + Intronic
1156622006 18:38864047-38864069 GCAGTGTCCTGAGGCTGTGCTGG - Intergenic
1159025359 18:63178243-63178265 GCTGTGGTCCGCCGCTGAACAGG + Intronic
1161181091 19:2882801-2882823 GCCTTGGCCTCCCGCAGAGCTGG + Exonic
1161514532 19:4689327-4689349 CCAGTGCCCGTCCGCTGAGCTGG - Intronic
1162086833 19:8254501-8254523 TCATTGGCCTGCCCCTGAGCCGG + Exonic
1162809007 19:13153260-13153282 GCGGTGGCCTGCGGCTGCACCGG + Exonic
1164609743 19:29623985-29624007 GCAGGGGCATGGCGCTGAGGAGG + Intergenic
1165821058 19:38676461-38676483 GCAGTGTCCTGCGACTGGGCTGG + Intronic
1166161147 19:40954306-40954328 CCTGTGGAATGCCGCTGAGCAGG - Intergenic
1167304062 19:48696756-48696778 GCAGTGGGGTGCGACTGAGCCGG + Intronic
1167308892 19:48724876-48724898 GCCGGGGCCTGGCGCGGAGCTGG - Exonic
925287393 2:2724725-2724747 CCAGTGGGGTGCCTCTGAGCTGG - Intergenic
928235660 2:29537332-29537354 GCAGTGTCATGAGGCTGAGCAGG - Intronic
930931216 2:56886008-56886030 GCAGTGTCCTGAGGCTGTGCAGG - Intergenic
932432382 2:71683713-71683735 CCAGTGGCCTGGTGCTGACCAGG - Intronic
934160983 2:89249308-89249330 GCAGGGTCCTGCCACAGAGCAGG + Intergenic
934206294 2:89933125-89933147 GCAGGGTCCTGCCACAGAGCAGG - Intergenic
938142496 2:128808197-128808219 GCAGGTGCCTGCCACTGTGCTGG + Intergenic
940910387 2:159205023-159205045 GCAGTGCCCTGCAGCTGGGGTGG + Intronic
946374810 2:219301687-219301709 GCAGAGGCTGGCCGCTGTGCTGG - Exonic
946487450 2:220114385-220114407 GCTCTGCCCTGCCCCTGAGCTGG + Intergenic
947933949 2:233987489-233987511 CCAGTGGCCTCCCCCTGAGCAGG + Intronic
948542407 2:238700004-238700026 GAAGTGGCTTGGCCCTGAGCAGG + Intergenic
948836538 2:240628757-240628779 GCAGTGGCTTCCTGCTGGGCTGG - Intronic
1169200510 20:3706934-3706956 GCAGTGGCCAGGAGCTGGGCAGG - Intronic
1170694690 20:18647731-18647753 GCAGTGGGCAGCCACTGAGGAGG + Intronic
1172650875 20:36500488-36500510 CCAGGGGCCTGCCGCCGAGACGG + Exonic
1173140229 20:40475412-40475434 GTTCTGGCCTGCCTCTGAGCAGG - Intergenic
1173233802 20:41225347-41225369 TCAGTGGCCAGCCTCTGAGTGGG - Intronic
1173399294 20:42710383-42710405 GCAGTGTCCTGAGGCTGGGCAGG - Intronic
1175606906 20:60318526-60318548 ACAGTGGCCTATCCCTGAGCAGG - Intergenic
1175942690 20:62545250-62545272 GCAGAGGACTGAGGCTGAGCAGG - Intergenic
1176148358 20:63575356-63575378 CCAGGGGCCGGGCGCTGAGCAGG + Intergenic
1176250128 20:64116675-64116697 GCTGAGGCCTGGGGCTGAGCTGG - Intergenic
1179996371 21:44976246-44976268 GCAGAGGCCTGCAGCAGAGTGGG - Intronic
1180115791 21:45704159-45704181 GCACTGCCCAGCCGCTGAGTGGG + Intronic
1180140196 21:45888557-45888579 GCAGGGCCCTGCCCCGGAGCAGG - Intronic
1180143198 21:45905487-45905509 ACAGTGTGCTGCCGCTGACCTGG - Intronic
1181107486 22:20583675-20583697 GCAGTGGCCTGACCATCAGCTGG + Intronic
1181812731 22:25413832-25413854 GCAGTGTCCTGAGGCTGTGCAGG + Intergenic
1182588712 22:31362614-31362636 GCAGTGGCCTGCCAAAGTGCTGG + Intergenic
1183947091 22:41332632-41332654 GCAGGGGCATGCCCTTGAGCTGG - Intronic
1184242410 22:43218115-43218137 GCAGAGGCCTGCCGGGGAGAAGG - Intronic
1185015371 22:48339634-48339656 GCTGGGCCCTGCCCCTGAGCTGG + Intergenic
949950103 3:9221950-9221972 GCCCTGGCCAGGCGCTGAGCAGG - Intronic
950008035 3:9704051-9704073 ACCGTGTCCTGCCGGTGAGCGGG + Exonic
954922484 3:54203705-54203727 TCAGTGGCCTGCCTGTGTGCTGG + Intronic
961333449 3:126156402-126156424 GCAGTGGCCAGGAGCTGAGGAGG + Intronic
961366030 3:126399976-126399998 ACAATGGCCAGCCGCTGAGCCGG - Intronic
961658634 3:128456902-128456924 CCAGCAGCCTGCCACTGAGCAGG - Intergenic
962536397 3:136333140-136333162 TCTGTGGCCTCCCACTGAGCTGG + Intronic
965865456 3:173199648-173199670 GCAGTGTCCTGAGTCTGAGCAGG + Intergenic
967883689 3:194318855-194318877 GCAGTGTCCTGAGGCTGAACTGG + Intergenic
968142831 3:196273027-196273049 GCAGTGGCCGGACCCTGTGCTGG - Intronic
968657346 4:1784377-1784399 GCAGGGGCCTTCTCCTGAGCTGG + Intergenic
968732473 4:2276127-2276149 GCAGCGGGCTGCGGCAGAGCGGG + Intronic
971923614 4:32976814-32976836 GCAGTTGCCTGACATTGAGCAGG + Intergenic
973982870 4:56320902-56320924 GCACTGGCCTCCCCCTGAGGTGG + Intronic
978205281 4:106073701-106073723 GCTGTGCCCTGCCCCAGAGCTGG + Intronic
979027574 4:115596879-115596901 GCAGTGTCCTGAGGCTGTGCAGG - Intergenic
979606519 4:122644404-122644426 GCAGTGGCCTGCGGGTCTGCAGG + Intergenic
980958589 4:139453379-139453401 GCTGTGGGCTGCCGGAGAGCAGG - Intronic
983209563 4:164945001-164945023 GCAGCTTCCTGCCGCTGAGGAGG + Intergenic
986725693 5:10594827-10594849 GGAGTTGACTGCCGTTGAGCGGG + Intronic
987668169 5:20972615-20972637 CCAGTGGCCAGCGGCTCAGCTGG + Intergenic
988823950 5:34915823-34915845 GCTGTGGCGTGCCGCTTAGCTGG - Exonic
989103783 5:37842185-37842207 GCAGATGCCTGCTGCTGAGGGGG - Intergenic
989455365 5:41637581-41637603 GCAGTGGCCTGAGGCTGAGTGGG - Intergenic
990006030 5:50945334-50945356 GCAGTGTCCTGAGGATGAGCAGG - Intergenic
990364252 5:55053675-55053697 ACAGTGGCCTGTGGCTGAGCAGG + Intergenic
992002811 5:72452019-72452041 GCAGTGGGCAGCCACTGGGCTGG + Intronic
994157792 5:96523026-96523048 GCAGTTGCCTGCTGCTGAAGAGG + Intergenic
995182355 5:109240677-109240699 GAAGGGGCCTGCAGCAGAGCTGG + Intergenic
997235784 5:132271314-132271336 CCAGAGGCCTCCCGCGGAGCCGG + Exonic
998417809 5:141958310-141958332 TAAGTGGCCTGCCGCTGAGGAGG + Exonic
999298321 5:150474486-150474508 GCGGTGGCCAGCAGGTGAGCTGG - Intergenic
1000782516 5:165500140-165500162 GCAGTGGTCTGATACTGAGCTGG - Intergenic
1001963293 5:175893642-175893664 GCACAGGCCTGACTCTGAGCTGG + Intergenic
1002189771 5:177472520-177472542 GCTGTTGTCTCCCGCTGAGCTGG - Intronic
1002570808 5:180138312-180138334 GAAGAGGCCTGCCCCTGAGTGGG - Exonic
1002962204 6:1925969-1925991 TCTGTGGCCTGCCGGTGTGCTGG - Intronic
1006996358 6:38264872-38264894 GCAGAGGCCTGCCTCTGAATGGG + Intronic
1007307557 6:40918809-40918831 TCAGTGGCCTGCTGGTGTGCCGG - Intergenic
1008226169 6:48919778-48919800 GCAGTGTCCTGAGGCTGAGCAGG - Intergenic
1010490968 6:76476376-76476398 GCACTGGGCTGCAGCTGATCAGG - Intergenic
1010630504 6:78192127-78192149 GCAGTGTCCTGAGGCTGCGCTGG + Intergenic
1010785367 6:79993994-79994016 GCAGTATCCTGAAGCTGAGCAGG - Intergenic
1016454339 6:144215646-144215668 GTAGGGGCCTGTGGCTGAGCTGG - Intergenic
1019321342 7:416866-416888 GCAGTGACCTGCCACTGCGCTGG - Intergenic
1020233756 7:6339869-6339891 TCAGTTGCCTGACGCCGAGCTGG - Intronic
1020397799 7:7736871-7736893 CCAGCGGCCTCCTGCTGAGCTGG + Intronic
1021710454 7:23411027-23411049 TCAGTGGCCTGACTTTGAGCAGG - Intronic
1022962210 7:35438189-35438211 GCAGAGGGCTGCTGGTGAGCAGG + Intergenic
1023542004 7:41275580-41275602 CCAGAGGCCTGGTGCTGAGCTGG - Intergenic
1024495057 7:50036293-50036315 ACAGGCGCCTGCCACTGAGCTGG + Intronic
1024785023 7:52897846-52897868 GCAGAGTACTGCCGGTGAGCAGG - Intergenic
1027267932 7:76504293-76504315 GCAGGGGCCTGTCCCTGTGCGGG + Intronic
1027319743 7:77004155-77004177 GCAGGGGCCTGTCCCTGTGCGGG + Intergenic
1031219420 7:118945818-118945840 TCAGTGGCCTGCTGGTGTGCCGG - Intergenic
1032094200 7:128929514-128929536 GGAAGGGCCTGACGCTGAGCTGG - Intergenic
1033784806 7:144717772-144717794 GCAGTGTCCTGAGGCTGTGCAGG - Intronic
1035023129 7:155810253-155810275 GTATTGGCCTCCCGCAGAGCAGG + Intronic
1035353783 7:158265185-158265207 GTAGTGGCCTCCCACTGACCTGG + Intronic
1037436862 8:18872073-18872095 GCAGTGACCTGCCACTCTGCAGG - Exonic
1046888927 8:119400371-119400393 GCAGTGTCCTGAGGCTGCGCAGG - Intergenic
1047493541 8:125392942-125392964 GCAGTAACCTGCCTCTGAGTAGG - Intergenic
1048465151 8:134659364-134659386 GCAGTGGCCCACCCCAGAGCAGG + Intronic
1051887028 9:21904145-21904167 TCAGTGGCCTGCCAGTGTGCTGG + Intronic
1052999732 9:34571361-34571383 GCAGTGGCCTGGCACTGAGGCGG - Intronic
1053412428 9:37924322-37924344 GCAGCTGCCGGCCGCCGAGCAGG + Intronic
1056021251 9:82440648-82440670 GCAGTGTCCTGAGGCTGTGCAGG - Intergenic
1057189904 9:93081215-93081237 GCAGTGGCCAACCGCAGAGATGG - Intronic
1057227147 9:93298363-93298385 GCAGTGCCCTGCAGAGGAGCAGG - Intronic
1057332480 9:94128817-94128839 GCAGTGTCCTGAGGCTGTGCAGG - Intergenic
1057405945 9:94770917-94770939 GAAGTAGCCAGCTGCTGAGCTGG - Intronic
1057805449 9:98216598-98216620 GCAGTGGCCAGCGCCAGAGCTGG - Intronic
1057857023 9:98609710-98609732 GGAGTGGCCTGGGGCAGAGCTGG + Intronic
1060055451 9:120409126-120409148 GCAGCGGCCAGGAGCTGAGCAGG - Exonic
1060209275 9:121700028-121700050 GCAGTGCCCAGGCCCTGAGCTGG + Intronic
1061953295 9:133948468-133948490 CCAGTCGCCTGCCCCTGACCTGG - Intronic
1062073649 9:134572667-134572689 CCACCCGCCTGCCGCTGAGCGGG + Intergenic
1062086064 9:134649136-134649158 CCAGTGGCCTGGGGCTGGGCTGG - Intronic
1062141455 9:134961313-134961335 GCAGAGGCCGGTGGCTGAGCTGG + Intergenic
1188016426 X:25112269-25112291 GCAGTGTCCTAAGGCTGAGCAGG + Intergenic
1189070452 X:37857543-37857565 GCAGTGTCCTGAAGCTGTGCAGG + Intronic
1189899430 X:45690594-45690616 GCAGTGTCCTGAGGCTGTGCAGG - Intergenic
1190339611 X:49286298-49286320 GAAGTGGCCTGGCCCTGAGCGGG + Exonic
1191949422 X:66572252-66572274 GCAGTGCCCTGTGGCTGAGCTGG + Intergenic
1191995810 X:67094279-67094301 GCAGTGTCCTGAGGCTGGGCAGG - Intergenic
1193026324 X:76849771-76849793 GCAGAGGCCTGCTGCAGAGGTGG - Intergenic
1196619666 X:117807444-117807466 GTATTGTCCTGCAGCTGAGCTGG - Intergenic
1196687722 X:118526536-118526558 GCAGGGGCCAGCCCCTGACCTGG + Intronic
1197271238 X:124426895-124426917 TCAGTGCCCTGCCACTGAGAGGG + Intronic
1198222162 X:134612789-134612811 GCTTTGCCCTGCCCCTGAGCCGG + Intronic
1199237743 X:145510349-145510371 GCAGTGTCCTGAGACTGAGCAGG - Intergenic
1199673603 X:150166377-150166399 GCAATGGCCTCCAGCTGACCTGG - Intergenic
1201727806 Y:17172671-17172693 TCAATGGCCTGCCCATGAGCTGG + Intergenic
1201765326 Y:17569358-17569380 GCACTGGCCTGCCACTGGGCCGG + Intergenic
1201836226 Y:18336631-18336653 GCACTGGCCTGCCACTGGGCCGG - Intergenic