ID: 919753652

View in Genome Browser
Species Human (GRCh38)
Location 1:201053507-201053529
Sequence GGCTGATCAAGCTGCTGAGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 154}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919753652_919753659 18 Left 919753652 1:201053507-201053529 CCGGCTCAGCAGCTTGATCAGCC 0: 1
1: 0
2: 0
3: 12
4: 154
Right 919753659 1:201053548-201053570 GGAAGAAGGCGCTGGAGATGCGG 0: 1
1: 1
2: 5
3: 91
4: 710
919753652_919753657 4 Left 919753652 1:201053507-201053529 CCGGCTCAGCAGCTTGATCAGCC 0: 1
1: 0
2: 0
3: 12
4: 154
Right 919753657 1:201053534-201053556 GACACGGAACAGGCGGAAGAAGG 0: 1
1: 1
2: 1
3: 5
4: 131
919753652_919753660 19 Left 919753652 1:201053507-201053529 CCGGCTCAGCAGCTTGATCAGCC 0: 1
1: 0
2: 0
3: 12
4: 154
Right 919753660 1:201053549-201053571 GAAGAAGGCGCTGGAGATGCGGG 0: 1
1: 0
2: 4
3: 35
4: 393
919753652_919753654 -6 Left 919753652 1:201053507-201053529 CCGGCTCAGCAGCTTGATCAGCC 0: 1
1: 0
2: 0
3: 12
4: 154
Right 919753654 1:201053524-201053546 TCAGCCTCATGACACGGAACAGG 0: 1
1: 0
2: 0
3: 1
4: 78
919753652_919753655 -3 Left 919753652 1:201053507-201053529 CCGGCTCAGCAGCTTGATCAGCC 0: 1
1: 0
2: 0
3: 12
4: 154
Right 919753655 1:201053527-201053549 GCCTCATGACACGGAACAGGCGG 0: 1
1: 0
2: 0
3: 7
4: 74
919753652_919753658 10 Left 919753652 1:201053507-201053529 CCGGCTCAGCAGCTTGATCAGCC 0: 1
1: 0
2: 0
3: 12
4: 154
Right 919753658 1:201053540-201053562 GAACAGGCGGAAGAAGGCGCTGG 0: 1
1: 0
2: 1
3: 14
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919753652 Original CRISPR GGCTGATCAAGCTGCTGAGC CGG (reversed) Exonic
900524032 1:3119832-3119854 GGCTGTGTCAGCTGCTGAGCAGG - Intronic
905144962 1:35881195-35881217 GGCTGATGATGCTGCCGATCTGG - Intronic
907217154 1:52874101-52874123 GACTGATCAAGATGGTGATCAGG - Intronic
912565623 1:110585346-110585368 AGCTGACCGAGCTGCTGGGCTGG - Intergenic
916802211 1:168226087-168226109 AGCTGAAGAAGGTGCTGAGCGGG + Exonic
916923348 1:169492173-169492195 GGCTGAGCAGGCTGATGAGTAGG - Intergenic
918151698 1:181802518-181802540 CGCTGATCCAGCTCCTGAGATGG + Intronic
919753652 1:201053507-201053529 GGCTGATCAAGCTGCTGAGCCGG - Exonic
1063579187 10:7290537-7290559 GGATTATAAAGCTGCCGAGCTGG + Intronic
1063876302 10:10482933-10482955 GGCAGGTGAAGCAGCTGAGCAGG - Intergenic
1067526567 10:47042920-47042942 TGATGATCAGGCTGCAGAGCAGG + Intergenic
1068046544 10:51893408-51893430 GGCTGATGAAGCTGCTGTCAGGG + Intronic
1070799713 10:79238088-79238110 GGCTGAGCAGGTAGCTGAGCAGG + Intronic
1079393224 11:20040166-20040188 TGCGGATCTAGATGCTGAGCTGG - Intronic
1079747868 11:24155723-24155745 GGCTGATCAAAGTGATCAGCTGG - Intergenic
1082027404 11:47582882-47582904 GGCTGCTCAAGAGGCTGAGGTGG + Intronic
1083782806 11:64926727-64926749 AGCTGCACGAGCTGCTGAGCCGG + Exonic
1085617907 11:78015579-78015601 AGCTGATCAAGCTACTATGCAGG + Intergenic
1086155369 11:83659677-83659699 GGCTAAGTAAGCAGCTGAGCTGG + Intronic
1088688696 11:112306202-112306224 GCCAGATCCAGTTGCTGAGCTGG + Intergenic
1094608646 12:31972030-31972052 GGCTTTTCAGGTTGCTGAGCAGG + Intronic
1094691431 12:32773259-32773281 GGCCAGTCAAGCTGCAGAGCAGG - Intergenic
1095409839 12:41909524-41909546 GGCTGAGCAGGCTGCAGAGGTGG - Intergenic
1096189840 12:49609330-49609352 GGCAGCTCAGGCTGCTGATCTGG - Intronic
1098308263 12:69123015-69123037 GGCTGAGCAGCCTGCTGCGCTGG + Intergenic
1102131927 12:110538210-110538232 TGCTGAGCAAGCTCATGAGCTGG - Exonic
1104000440 12:124856761-124856783 GGCTGATAAAGGCGCAGAGCGGG + Intronic
1106032003 13:26012548-26012570 GCCTGATCAAGAGGCTGGGCCGG + Exonic
1112794180 13:103036857-103036879 GGGGAATGAAGCTGCTGAGCAGG + Intergenic
1113222041 13:108116006-108116028 GACTGATTAAGCTGATGAGATGG + Intergenic
1113480706 13:110618399-110618421 GGTTGATCAAGTTGCTGTGAAGG + Intronic
1114222692 14:20711167-20711189 GGCTGATAAAGCTGCAAAGCAGG - Intergenic
1116842038 14:49828290-49828312 GACTGTTGAAGCTGCTGAGAAGG - Exonic
1117057124 14:51923895-51923917 GGCTGATCATGCGGGTCAGCAGG + Intronic
1117384441 14:55196658-55196680 GGCTGATCAAGCGACTGCTCAGG - Intergenic
1118318770 14:64741425-64741447 GGCTGAGCACGCTGCTGCTCCGG - Exonic
1120153458 14:81064302-81064324 GGCTGATCAAGTTTCTGATTAGG + Intronic
1120252473 14:82075756-82075778 TGCTGTCCAAGGTGCTGAGCAGG - Intergenic
1121012034 14:90525501-90525523 GACTGATCAGGCTACCGAGCCGG - Exonic
1122756097 14:103981344-103981366 GCCTGATCCAGCTCCTCAGCGGG - Intronic
1127833108 15:62768127-62768149 TGCTGCTGAAGCTGCTGATCTGG - Intronic
1128784377 15:70384008-70384030 GGCTGAGTAAGATGCTGAGATGG - Intergenic
1129770761 15:78201899-78201921 GGCTCATGAAGTTGCTGTGCAGG + Intronic
1130242293 15:82206012-82206034 AGCTCTTGAAGCTGCTGAGCAGG - Intronic
1130458087 15:84134810-84134832 AGCTCTTGAAGCTGCTGAGCAGG + Intergenic
1130968928 15:88717520-88717542 GTCTGATCAAGGGGCTGGGCAGG - Intergenic
1131401399 15:92128347-92128369 GGCTGAGCCAGGTGCTGTGCTGG - Exonic
1132601629 16:775485-775507 GGTTGGCCAAGCAGCTGAGCTGG + Exonic
1132651112 16:1021822-1021844 GGGTGAACAAGCTGCTGACGGGG - Intergenic
1132906833 16:2286771-2286793 TTCTGTTCAAGCTGCTGTGCGGG - Exonic
1133046694 16:3092130-3092152 GGCTGCCCAGCCTGCTGAGCCGG - Exonic
1133417906 16:5620789-5620811 GGCTACTCAAGCAGCTGAGGTGG - Intergenic
1134299923 16:12981586-12981608 CTCTGATCATGATGCTGAGCTGG - Intronic
1136247418 16:28983976-28983998 GGCAGATCAAGAAGCTGGGCCGG - Intronic
1145712498 17:26990535-26990557 GGCTGAGCGATCTGCTGGGCTGG + Intergenic
1146034204 17:29391164-29391186 GGGTGAAGAAGCTGGTGAGCTGG + Intronic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1148128482 17:45248618-45248640 TGCTGTTCAAGCTGCTGGGCCGG - Intergenic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150970662 17:70023773-70023795 GGCAGATCAAGCTACCAAGCTGG - Intergenic
1152410006 17:80118369-80118391 GGCTGCTCAGGCTGGTGGGCAGG + Intergenic
1152740657 17:82017001-82017023 GTCTGAGCCAGCTGCTGAGGAGG + Exonic
1155526204 18:26718446-26718468 GGCTAATCAAGATGCTGATGAGG - Intergenic
1156384427 18:36592889-36592911 GCCTGACCAAACTCCTGAGCAGG - Intronic
1157663374 18:49465371-49465393 GACTGAGCAAGCTCCTGAACCGG + Intergenic
1158856640 18:61549589-61549611 GCCTTGGCAAGCTGCTGAGCAGG + Intronic
1159942596 18:74419959-74419981 TGCTGAGCAAGCTGCTGAAATGG - Intergenic
1160766621 19:811395-811417 CGCTGCTCCAGCTGCGGAGCTGG + Exonic
928033354 2:27799787-27799809 GGCTGCGCCAGCTGCTGAGATGG + Intronic
928401784 2:30984273-30984295 GGCTGAACAGGCTGCTGGCCCGG - Intronic
929864683 2:45708176-45708198 GGCAGAGCAAGTTGCTAAGCTGG + Intronic
932764602 2:74461907-74461929 GGCTGAGGTAGCTGCTGAGCTGG - Exonic
933424250 2:82089642-82089664 TGCAGATCAAACAGCTGAGCGGG - Intergenic
939247536 2:139645144-139645166 GGCAGCTCAGGCTGCTGATCTGG + Intergenic
944666753 2:201965276-201965298 TGCTGTTGGAGCTGCTGAGCAGG - Intergenic
944741581 2:202618075-202618097 GGCTGATGAGGCTGATGAGTAGG - Intergenic
947586175 2:231358284-231358306 GTCAGAGCAAGCTCCTGAGCAGG - Intronic
947751454 2:232534924-232534946 GGCTGATCACTCTGTTGAGGAGG - Intronic
1172859249 20:38034201-38034223 GCCTGATCGAGCTTCTGAGATGG + Intronic
1174153855 20:48504309-48504331 GGCTGTTGGAGCTGCTGATCAGG - Intergenic
1174154072 20:48505484-48505506 GGCTGGTGGAGCTGCTGATCAGG - Intergenic
1174154222 20:48506267-48506289 GGCTGGTGGAGCTGCTGATCAGG - Intergenic
1174154257 20:48506463-48506485 GGCTGCTGGAGCTGCTGATCAGG - Intergenic
1174154573 20:48508133-48508155 GGCTGGTGGAGCTGCTGATCAGG - Intergenic
1174154846 20:48509602-48509624 GGCTGGTGGAGCTGCTGATCAGG - Intergenic
1174155081 20:48510875-48510897 GGCTGGTGGAGCTGCTGATCAGG - Intergenic
1174155488 20:48513032-48513054 GGCTGGTGGAGCTGCTGATCAGG - Intergenic
1174155675 20:48514012-48514034 GGCTGCTGGAGCTGCTGATCAGG - Intergenic
1174155901 20:48515232-48515254 GGCTGGTGGAGCTGCTGATCAGG - Intergenic
1175571725 20:60028133-60028155 TGCTGAACAAGGTGCTGAGCAGG + Intronic
1175991296 20:62790826-62790848 GTCAAATCAAGCTGCTGACCAGG + Intergenic
1178797079 21:35755087-35755109 GGTTCATCAAGGAGCTGAGCTGG - Intronic
1179329945 21:40390185-40390207 GACTCATCCACCTGCTGAGCAGG - Intronic
1179384737 21:40931376-40931398 GGCTTCTCATGCTGCTGACCTGG - Intergenic
1180245641 21:46545702-46545724 GGCTGCTCAATCTCCTGGGCAGG - Intronic
1181639652 22:24189900-24189922 GGCTGACCCAGCTGCAGGGCAGG - Intergenic
1185251542 22:49804267-49804289 GGCTGCTCAAGCGGCTGTCCAGG - Exonic
950425627 3:12923430-12923452 GGCTTCTCCAGGTGCTGAGCAGG + Intronic
953852687 3:46478225-46478247 GGCTGCCCAGGCTGCTGAGAGGG - Intronic
955556137 3:60139487-60139509 GGCTGAGAAAGCTTCTAAGCTGG - Intronic
959102037 3:102021881-102021903 GCCTGATCATGCTGATGATCAGG + Intergenic
961210451 3:125121066-125121088 GGCAGGGAAAGCTGCTGAGCAGG - Intronic
961315878 3:126035339-126035361 GGCTGACCAAGCTGGTGATGAGG + Intronic
961782213 3:129326913-129326935 AGCGGATCAATCTGCCGAGCTGG + Intergenic
967059411 3:185858753-185858775 AGCTCATCAAGAGGCTGAGCAGG - Intergenic
967893352 3:194378873-194378895 GGCCCATCCAGCTGCAGAGCAGG + Intergenic
969163015 4:5278335-5278357 GGCAGATCAAGGAGCTGAGCTGG + Intronic
971335472 4:25719632-25719654 GGCTGATGAGGCTGATGAGCAGG + Intergenic
972290511 4:37686365-37686387 GGCTGATCGAGTGGCTGGGCTGG + Exonic
976028346 4:80719765-80719787 GGCTGGACAAGATGGTGAGCTGG - Intronic
978069232 4:104446186-104446208 GGCTGATAAAGTAACTGAGCTGG - Intergenic
979733399 4:124052493-124052515 GGCTGATCAAGGGGCTGAGGGGG + Intergenic
980659741 4:135841778-135841800 GGATGATCAAGCTGGCGACCTGG + Intergenic
982442770 4:155456297-155456319 GGCTGATAAGGCTGATGAGCAGG + Intergenic
984102561 4:175502722-175502744 GGCTGATCCAGATGTTGAGGAGG - Intergenic
985705593 5:1399846-1399868 GGCAGAACAAGACGCTGAGCAGG - Intronic
991557552 5:67912590-67912612 GGCAGATTAAGCAGCTGAGCAGG + Intergenic
997228642 5:132227755-132227777 GGTTGATCTGGCGGCTGAGCGGG + Intronic
999582188 5:153051151-153051173 GGCTAGTTAAGCTGCAGAGCAGG + Intergenic
1001010424 5:168092804-168092826 AGCTGAGCCAGCTGCTGTGCAGG - Intronic
1004427098 6:15513880-15513902 GGCAGATCATGTAGCTGAGCAGG - Intronic
1004702712 6:18093896-18093918 GGCTGGTCAAACTCCTGACCTGG + Intergenic
1005826558 6:29634773-29634795 GGCTGATCCAGGTGCTGAGTTGG + Intergenic
1006455872 6:34131598-34131620 GGGTGAGGAAGCTGGTGAGCGGG - Intronic
1015350292 6:132210197-132210219 GGCAGCTCAGGCTGCTGATCCGG + Intergenic
1016969508 6:149749493-149749515 GACTGATCAGGCTACCGAGCCGG + Exonic
1019673851 7:2299053-2299075 GACAGAGCAAGCTGCTGACCAGG + Intronic
1024548355 7:50540606-50540628 GGGTGATCCAGCTGCTTGGCTGG - Intronic
1030212373 7:107009036-107009058 AGCTGATAAAGCCGCTGAGAAGG + Intergenic
1030536821 7:110777565-110777587 TGCTGAGAAAGCTGCAGAGCTGG + Intronic
1040457250 8:47611075-47611097 GGCTGATTGAGCAGCTGAGAAGG + Intronic
1042331641 8:67586848-67586870 GGCTGATGAGGCTGATGAGTAGG + Intronic
1043543368 8:81288172-81288194 GGCTGATGAAGCCGGTGAACTGG + Intergenic
1044753288 8:95436722-95436744 GGCAGATCAGGCTGGAGAGCTGG - Intergenic
1045064425 8:98433256-98433278 GGCTGACAGAGGTGCTGAGCAGG - Intronic
1045398376 8:101784686-101784708 GGCTACTCAAGCAGCTGAGGTGG + Intronic
1047081658 8:121468282-121468304 GACTGATCAAGTAGCTCAGCAGG + Intergenic
1047285875 8:123486846-123486868 GGCTGCTGAGGCTGCTGAACTGG + Intergenic
1047906725 8:129480575-129480597 GGCTGCTCAAGGAGCAGAGCTGG - Intergenic
1049643457 8:143725820-143725842 CGCTGCTCAAGCAGATGAGCAGG + Exonic
1052396961 9:27950056-27950078 GGCTGATGAGGCTGCGGAGGTGG + Exonic
1052857143 9:33414558-33414580 TGCTGATTAAGAAGCTGAGCTGG - Intergenic
1058325565 9:103693045-103693067 TGGTGATCAAGCTGCAGACCTGG - Intergenic
1058986709 9:110214644-110214666 TGCTGCTGAAGCTGCTGAACAGG + Intergenic
1059378568 9:113905878-113905900 GAATGATCAAGCTGCAGGGCAGG - Intronic
1059451993 9:114376480-114376502 GCCTGAGCAAGCCACTGAGCTGG - Exonic
1060601453 9:124881047-124881069 AGCTGATCATGCAGCTGTGCTGG + Intronic
1061849759 9:133407474-133407496 GGCAGAGCCAGCTGCTCAGCAGG + Intronic
1062323022 9:135999567-135999589 GGCTGCTCAGATTGCTGAGCAGG - Intergenic
1062532619 9:137008523-137008545 GGCTGAGCAAGCAGCCGAGAGGG + Exonic
1186138984 X:6550869-6550891 GGCTGCTCAAGCTGCTCTCCAGG + Intergenic
1193551094 X:82893567-82893589 AGCTGATCAGGCTGCTGATCTGG - Intergenic
1195265621 X:103176576-103176598 GGATGTTCAAGCTGCAGTGCAGG - Intergenic
1198968240 X:142250484-142250506 GGCAGCTCAGGCTGCTGATCCGG + Intergenic
1199720426 X:150539568-150539590 GGCTGATCTAGAAGCTGAGCTGG + Intergenic
1201738992 Y:17303662-17303684 GAGTGAGCATGCTGCTGAGCTGG + Intergenic