ID: 919755106

View in Genome Browser
Species Human (GRCh38)
Location 1:201061761-201061783
Sequence CTCCAAAGTAGGCCTGACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 154}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919755106_919755112 18 Left 919755106 1:201061761-201061783 CCCTGGTCAGGCCTACTTTGGAG 0: 1
1: 0
2: 0
3: 13
4: 154
Right 919755112 1:201061802-201061824 TCAAACCATCAGAGAGTTGGTGG 0: 1
1: 0
2: 1
3: 16
4: 183
919755106_919755115 27 Left 919755106 1:201061761-201061783 CCCTGGTCAGGCCTACTTTGGAG 0: 1
1: 0
2: 0
3: 13
4: 154
Right 919755115 1:201061811-201061833 CAGAGAGTTGGTGGGTTTGTTGG 0: 1
1: 0
2: 4
3: 29
4: 257
919755106_919755111 15 Left 919755106 1:201061761-201061783 CCCTGGTCAGGCCTACTTTGGAG 0: 1
1: 0
2: 0
3: 13
4: 154
Right 919755111 1:201061799-201061821 CCATCAAACCATCAGAGAGTTGG 0: 1
1: 0
2: 0
3: 18
4: 278
919755106_919755113 19 Left 919755106 1:201061761-201061783 CCCTGGTCAGGCCTACTTTGGAG 0: 1
1: 0
2: 0
3: 13
4: 154
Right 919755113 1:201061803-201061825 CAAACCATCAGAGAGTTGGTGGG 0: 1
1: 0
2: 1
3: 12
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919755106 Original CRISPR CTCCAAAGTAGGCCTGACCA GGG (reversed) Intronic
900351318 1:2236149-2236171 AGCCCAAGAAGGCCTGACCAAGG - Intronic
902481225 1:16712943-16712965 TTCCCAAGTAGGCCTGGCCCAGG + Intergenic
904488298 1:30842254-30842276 CTCCAAACAAGGCTTGACCAAGG - Intergenic
907272439 1:53298785-53298807 CTCCAAGGTCAGCCTGCCCAAGG - Intronic
907336487 1:53702995-53703017 CTTCAAAGTCGGCCAGACCCAGG + Intronic
907426817 1:54384998-54385020 CTCCAGAGTAGGCCTGGGCAGGG + Intronic
907562997 1:55408239-55408261 CCCCATAGTAGACCTTACCATGG - Intergenic
908494463 1:64680363-64680385 CTCCCAAGTAGCTCAGACCACGG - Intronic
909893079 1:81032483-81032505 CTCCTAAGTAGCTGTGACCACGG + Intergenic
913691297 1:121282286-121282308 CTCCAGAGTTAGCCTGTCCAAGG - Intronic
914146246 1:144997695-144997717 CTCCAGAGTTAGCCTGTCCAAGG + Intronic
915954909 1:160213470-160213492 CACCGAAGAAGGCCTGAGCAAGG + Exonic
917524963 1:175780389-175780411 CTCCCAAGCAGGCCTCACCATGG - Intergenic
917536595 1:175878643-175878665 TTCCCAAGCAGGCCTGGCCATGG + Intergenic
917751376 1:178056578-178056600 CTCCAAGGTAGCACTGACCCTGG - Intergenic
919755106 1:201061761-201061783 CTCCAAAGTAGGCCTGACCAGGG - Intronic
920478621 1:206300762-206300784 CTCCAGAGTTAGCCTGTCCAAGG - Intronic
1064001651 10:11668475-11668497 CTCCAAAGTAGCTGGGACCACGG - Intergenic
1064594289 10:16927891-16927913 CTCCAAAGGAGGTGTGTCCAGGG - Intronic
1065817343 10:29494046-29494068 CTCCCAAGTAGGCGGGACTATGG - Intronic
1067225393 10:44372945-44372967 CTCCACCCTAGGGCTGACCATGG + Intronic
1068905538 10:62317544-62317566 CCCCAAATTAGGCCCAACCACGG + Intergenic
1070950425 10:80426781-80426803 CCTCAAGGTAGGCCTGACCTAGG - Intronic
1074302453 10:112245006-112245028 CTCCAAAGTAGCTGGGACCACGG + Intergenic
1076164459 10:128270381-128270403 CTCCAAATGAGGCCTGAAGAAGG + Intergenic
1078534945 11:12165388-12165410 CACCAAAGGATGCCTGAACATGG - Intronic
1078693665 11:13607416-13607438 GACCAGAGTAGGCCTGACCGAGG + Intergenic
1082001354 11:47395162-47395184 GGCCAAAGTAGGCCTGGCCCTGG - Intergenic
1083265987 11:61547011-61547033 CTCCATGGTCGGCCTGCCCATGG + Intronic
1083471864 11:62889432-62889454 GGCCAAAGGAGGCCTCACCACGG + Intergenic
1083694474 11:64433475-64433497 CTCCAGAGTGAGCCTGGCCATGG + Intergenic
1085337319 11:75706183-75706205 CTCCAAAGCTTGCCTGACCACGG + Intergenic
1087691408 11:101324991-101325013 CTCCAAAGCAGGACTTCCCAGGG - Intergenic
1088513261 11:110599550-110599572 CCTAAAAGTAGGCCTCACCAGGG - Intronic
1089268269 11:117282449-117282471 CACCATGGCAGGCCTGACCATGG + Exonic
1092773753 12:11922862-11922884 CTCCAAAGCACACCTGACCCAGG + Intergenic
1094345310 12:29461564-29461586 CTTCTAAGCAGGCCTGAGCAAGG - Intronic
1095233985 12:39775595-39775617 ATCCAAAGCAAGCCTGGCCATGG + Intronic
1096614625 12:52824815-52824837 ATCCACAGTAGTCCTGACCATGG + Intronic
1098827108 12:75310329-75310351 GGCCAAAGTAGGCCTCACCAAGG + Intronic
1098938703 12:76509926-76509948 CTCCAAAGTAGTCAAGATCAAGG - Intronic
1103548564 12:121719461-121719483 CTCCCAAGTAGGTGGGACCATGG - Intronic
1104143927 12:126014197-126014219 CTCCAAGGTATGCCTGTGCAAGG - Intergenic
1110524229 13:76516860-76516882 CTACAAATTATGCTTGACCAGGG + Intergenic
1110906670 13:80898364-80898386 CTCCAAAGTAGGCTTTCCCTTGG + Intergenic
1113074963 13:106459073-106459095 CTCCAAACTACACCTGAACAAGG + Intergenic
1114001209 14:18249498-18249520 TTCCACAGTAGGCCTCACAACGG + Intergenic
1116927189 14:50651747-50651769 CTCCCAAGTAGGTGTGACTATGG + Intronic
1118108889 14:62694007-62694029 CTACAAAGTGTGCCTCACCATGG - Intergenic
1118316556 14:64729533-64729555 AGCCAAACAAGGCCTGACCAGGG + Intronic
1120393764 14:83942446-83942468 CTCAAAAGAAGGCATAACCATGG - Intergenic
1120707249 14:87757483-87757505 CTCCCAAGTAGGTGGGACCATGG + Intergenic
1121768516 14:96508884-96508906 CTCAAAAGAATACCTGACCAAGG + Intronic
1123799967 15:23809369-23809391 CTCCCAAGTAGACCTGATGATGG + Intergenic
1126214232 15:46136074-46136096 TCCCAAAGCAAGCCTGACCAGGG - Intergenic
1128152563 15:65372466-65372488 CTCAAAAGACAGCCTGACCAAGG - Intronic
1128386458 15:67152635-67152657 CTGAAAATTAGGCCTGACAATGG - Intronic
1128463349 15:67888176-67888198 CTCCAAGGCTGTCCTGACCAAGG - Intergenic
1133770267 16:8863653-8863675 GGCCAGAGTAGGCCTGGCCAAGG + Intronic
1135525392 16:23210092-23210114 CTCCTAAGTAGGCCTTGGCAAGG + Intronic
1137480735 16:48850057-48850079 CTGCCCAGGAGGCCTGACCATGG + Intergenic
1138057624 16:53852151-53852173 CTCCCAAGTAGTTGTGACCACGG - Intronic
1138206810 16:55131372-55131394 CTATAAAATAGGCCTGAGCAAGG + Intergenic
1139420859 16:66848805-66848827 CTCCAAAGCATGCCTCACCTGGG - Intronic
1140065362 16:71606739-71606761 CTCCAAAGCTGGCTTGCCCAAGG - Intergenic
1140605377 16:76530518-76530540 CTCTAAAATAGGCCTTAGCATGG + Intronic
1142989118 17:3717639-3717661 CTCCAAAGCACCCCTGACCTTGG - Intronic
1143015648 17:3889932-3889954 CTCAGAATGAGGCCTGACCAGGG - Intronic
1143850517 17:9808227-9808249 CTCCTAAGTGGGCCTTTCCAGGG - Intronic
1148546895 17:48526117-48526139 CTCCCATGTAGGCCTGTCTAGGG + Intergenic
1150841735 17:68613960-68613982 TTCCACAGTAGCTCTGACCATGG - Intergenic
1152249605 17:79204843-79204865 CTCCAAAGCCTGGCTGACCACGG - Intronic
1153710749 18:7796513-7796535 CTCCACAGCAGGTCTGAGCAGGG + Intronic
1157124035 18:44938106-44938128 CTCCAGAGTGGTCCTGACCATGG - Intronic
1160971613 19:1770312-1770334 CTCCCAAGTAGGTGGGACCACGG - Intronic
1161304105 19:3557451-3557473 CACCCAAGAAGGCCTGGCCAGGG - Exonic
1162547886 19:11341801-11341823 CTCCAAAGTAGCTCGGACTACGG - Intronic
1166624405 19:44336998-44337020 CTCCAGAGTAGCCGGGACCATGG + Intronic
1166713554 19:44952194-44952216 CTCCACAGGAGCCCTGTCCAAGG + Intronic
1167108922 19:47447536-47447558 CTCCAAAGTGGGCTTGGCCTCGG - Intronic
1167360734 19:49028979-49029001 CCCCACAGAAGGCCAGACCATGG + Intronic
1167362915 19:49039826-49039848 CCCCACAGAAGGCCAGACCATGG - Intergenic
1167365651 19:49053762-49053784 CCCCACAGAAGGCCAGACCATGG + Intergenic
1202715267 1_KI270714v1_random:38854-38876 TTCCCAAGTAGGCCTGGCCCAGG + Intergenic
925969361 2:9096070-9096092 CCCCACAGGAGGCCCGACCAGGG + Intergenic
930381288 2:50633477-50633499 CTTCATAGAAGGCTTGACCAAGG + Intronic
935043030 2:99452869-99452891 CTCCAAAGCAGGAATGACTAAGG + Intronic
936907422 2:117553307-117553329 GACCAAAGTAGGCCTGTACAAGG - Intergenic
937548573 2:123057108-123057130 CTCCAAATTAGGCAAGACAATGG + Intergenic
939773664 2:146357507-146357529 CTTCAAAGCAGGGCTGAACATGG - Intergenic
939889706 2:147721986-147722008 TTACAGAGTAGGGCTGACCATGG + Intergenic
940779200 2:157915295-157915317 CTCCCAAGTATGCCTAAACATGG - Intronic
944314677 2:198271592-198271614 CTCCACAGTATGTCTGACTATGG + Intronic
947112182 2:226730539-226730561 CTCCTAAGTTGGCCTGGCCATGG + Intergenic
947541821 2:230985161-230985183 CTCCAAAGTAGACCTGCCCCAGG - Intergenic
1168740362 20:185037-185059 CTACAAAGTAGGCATCACCCTGG + Intergenic
1169177653 20:3532676-3532698 CTCCAATGCAGGCCTGACAAAGG + Intronic
1170043482 20:12062152-12062174 CTCCCATGTAGCTCTGACCACGG - Intergenic
1172586789 20:36091329-36091351 CCCCAAAGCAGGACTGAACATGG - Intergenic
1172897126 20:38308090-38308112 CTGCGAATTAGGCCTGTCCAAGG - Intronic
1173938617 20:46891021-46891043 CTCCAAGGTAGGCATGACTGTGG + Intergenic
1174714691 20:52745423-52745445 ATCCAGAGTAGGCTAGACCAGGG - Intergenic
1175578593 20:60081065-60081087 CTCCAAAGTAGGAATGGGCAAGG + Intergenic
1175692458 20:61075456-61075478 GTCCAAAGGATGCCTGGCCAGGG - Intergenic
1175883508 20:62274266-62274288 GTCAAAAGCAGGCCAGACCATGG + Intronic
1179061644 21:37984747-37984769 CTCCTAAGCAGGTCTGACAATGG + Intronic
1179610524 21:42547400-42547422 CTCCTGAGGAGGCCTGGCCAGGG - Intronic
1180425720 22:15180296-15180318 TTCCACAGTAGGCCTCACAACGG + Intergenic
1182529103 22:30941595-30941617 CTCCACAACAGGCCTGACCAAGG + Intronic
1185041133 22:48504956-48504978 ATCCACAGTGGGCCTGAGCAGGG - Intronic
950216865 3:11166474-11166496 GTACAATGTAGGCCTCACCAGGG - Intronic
952875579 3:37941736-37941758 CTTCAAAGCAGGCCTGCCCCGGG + Intronic
956063163 3:65369184-65369206 CCCCAACCTTGGCCTGACCAAGG + Intronic
959770448 3:110089131-110089153 CTCCAAAGTAGCTGGGACCATGG + Intergenic
961602484 3:128072340-128072362 CCCCAGGGCAGGCCTGACCAGGG + Intronic
962006650 3:131356433-131356455 GTCAAATGTAGGCTTGACCAGGG - Intergenic
962944419 3:140154303-140154325 CTCCAAGGAAGGCCTGAGCTTGG + Intronic
971220049 4:24696994-24697016 CTCCAAAGCAGGCCTGCAAAAGG - Intergenic
977269740 4:94901699-94901721 CTCCAAAGTTGGCCTGAATATGG + Intronic
979577018 4:122304667-122304689 CTCCAAGGTATGCCTGTTCATGG + Intronic
985591846 5:769926-769948 CTCCCAAGGAGCCCTGACCGAGG + Intergenic
985609760 5:880878-880900 CTCCCAAGGAGCCCTGACCGAGG + Intronic
986931360 5:12826662-12826684 CTCCAATCTAGGGCTGAGCATGG - Intergenic
987134443 5:14887744-14887766 CTCCAGAGTAGCCCTGGGCATGG - Intergenic
989243604 5:39228489-39228511 TTCCAAAGTTGGCATGTCCATGG - Intronic
991363420 5:65844051-65844073 TCCCAATGTAGGCCAGACCATGG + Intronic
995210292 5:109530200-109530222 CTCCTAAGTAGCTCTGACTACGG + Intergenic
995385274 5:111581724-111581746 CTTCCAAGTAGGCCTTACTAAGG + Intergenic
999347933 5:150840799-150840821 CTCCAAGGTAGGACTGAGCTGGG - Intergenic
999407394 5:151318944-151318966 CTCCAAAGGAGGCCTGCTCAAGG - Intronic
1000780529 5:165474578-165474600 TTCCAAAGTAGTCCTGAGCTAGG + Intergenic
1002603186 5:180366552-180366574 CTCCATAGTTGGGCTGGCCAGGG + Intergenic
1002921311 6:1575289-1575311 CTACAGAGGAGGCCTGGCCAGGG - Intergenic
1007412447 6:41672985-41673007 CCCCAAAGTCGTCATGACCAGGG + Intergenic
1007459690 6:42009157-42009179 CTGATAAGTAGGCCTGACCTAGG - Intronic
1011359009 6:86501926-86501948 GGCCAAAGCAGGCCTGACTAAGG + Intergenic
1012411180 6:98959019-98959041 CTCCAAAGTAAATCTGAGCAAGG + Intergenic
1013053830 6:106563814-106563836 CTCCAAGCTAGGCCTGGCCCTGG + Exonic
1013789432 6:113819618-113819640 CTCCAGCGTAGCCCTGTCCAGGG - Intergenic
1015742754 6:136474836-136474858 CTCCCAAGTAGCCGGGACCACGG + Intronic
1019318747 7:405319-405341 CTACAAAGTGAGCCTGTCCAAGG - Intergenic
1021324782 7:19253509-19253531 CTCAAAGGTAGGCCTGCCAAAGG - Intergenic
1022927868 7:35074156-35074178 CTGCAAAGGACGGCTGACCAGGG + Intergenic
1024059907 7:45690025-45690047 CTCCAAAGGTGGTCTGACAATGG + Intronic
1028609393 7:92692660-92692682 CTCCAGAGTAGCCGGGACCACGG - Intronic
1031422877 7:121570190-121570212 CTCCAAGGTTGGACTGAGCATGG - Intergenic
1032253569 7:130278911-130278933 GTCCATTGTAGGCCTGGCCAGGG - Intronic
1033334283 7:140439150-140439172 CTCCCAAGTAGCTCGGACCACGG + Intergenic
1034029435 7:147743855-147743877 CTCCACAGTAGCCATCACCATGG - Intronic
1034568184 7:151932592-151932614 CTCCAAAGGTGGCCAGAACACGG + Intergenic
1035870886 8:3135044-3135066 CTCCCAAGTAGCCAGGACCACGG + Intronic
1047360253 8:124162595-124162617 CACCAAAGCAGGCCTGAGCTTGG - Intergenic
1048646425 8:136426423-136426445 CTACACAGTAGGCCAGTCCACGG - Intergenic
1049342117 8:142118785-142118807 CTACCCAGTAGGCCTTACCATGG + Intergenic
1053536145 9:38928198-38928220 ATCCAAACCAGGCCTGAGCATGG - Intergenic
1053604495 9:39643044-39643066 CTCCAAGGAAGGGCTGACAATGG - Intergenic
1053862310 9:42399067-42399089 CTCCAAGGAAGGGCTGACAATGG - Intergenic
1054249046 9:62699370-62699392 CTCCAAGGAAGGGCTGACAATGG + Intergenic
1054563160 9:66733903-66733925 CTCCAAGGAAGGGCTGACAATGG + Intergenic
1054629990 9:67435754-67435776 ATCCAAACCAGGCCTGAGCATGG + Intergenic
1060959983 9:127673591-127673613 CTCCAAAGCTGGTCTGGCCATGG - Intronic
1187149541 X:16669115-16669137 CTCCACAGTGGGCTTGAGCATGG + Intronic
1187521576 X:20019146-20019168 CTCCCAAGTAGCCAGGACCACGG + Intronic
1189190540 X:39098787-39098809 CTCCAAAATGGACCTGGCCATGG - Intergenic
1192581885 X:72290013-72290035 CTACATAGTAAGCCTGAGCATGG + Intronic
1194941341 X:100015058-100015080 CTCCTAGGTAAGACTGACCATGG - Intergenic
1199726676 X:150589846-150589868 CTACAAATTAGTCCTGACCTTGG - Intronic
1200342564 X:155413537-155413559 CTTCAAAGCAGGCCTGAAGATGG - Intergenic