ID: 919755351

View in Genome Browser
Species Human (GRCh38)
Location 1:201062827-201062849
Sequence GGATGGACATGAGTGCAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 189}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919755349_919755351 -7 Left 919755349 1:201062811-201062833 CCCTGATGGGCTGAGGGGATGGA 0: 1
1: 0
2: 5
3: 21
4: 205
Right 919755351 1:201062827-201062849 GGATGGACATGAGTGCAGCTTGG 0: 1
1: 0
2: 0
3: 26
4: 189
919755350_919755351 -8 Left 919755350 1:201062812-201062834 CCTGATGGGCTGAGGGGATGGAC 0: 1
1: 0
2: 5
3: 15
4: 149
Right 919755351 1:201062827-201062849 GGATGGACATGAGTGCAGCTTGG 0: 1
1: 0
2: 0
3: 26
4: 189
919755346_919755351 -5 Left 919755346 1:201062809-201062831 CCCCCTGATGGGCTGAGGGGATG 0: 1
1: 0
2: 2
3: 11
4: 205
Right 919755351 1:201062827-201062849 GGATGGACATGAGTGCAGCTTGG 0: 1
1: 0
2: 0
3: 26
4: 189
919755340_919755351 19 Left 919755340 1:201062785-201062807 CCTCAGAGGGGCATTTACTGAGT 0: 1
1: 0
2: 2
3: 15
4: 148
Right 919755351 1:201062827-201062849 GGATGGACATGAGTGCAGCTTGG 0: 1
1: 0
2: 0
3: 26
4: 189
919755347_919755351 -6 Left 919755347 1:201062810-201062832 CCCCTGATGGGCTGAGGGGATGG 0: 1
1: 0
2: 2
3: 29
4: 373
Right 919755351 1:201062827-201062849 GGATGGACATGAGTGCAGCTTGG 0: 1
1: 0
2: 0
3: 26
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919755351 Original CRISPR GGATGGACATGAGTGCAGCT TGG Intronic
900565674 1:3330836-3330858 GGAGGGCCCTGAGGGCAGCTCGG - Intronic
900670923 1:3854285-3854307 GGATGGAGATGACTGGAGCTGGG - Intronic
900780375 1:4614031-4614053 GGAGGGCCCTGAGGGCAGCTGGG + Intergenic
903181223 1:21605948-21605970 GGATGGGCATGTGGGCAGCAGGG + Intronic
903654861 1:24942964-24942986 GGCTGGAAATGTGGGCAGCTGGG + Intronic
903847757 1:26288570-26288592 GGATGGAGAGAGGTGCAGCTGGG + Intronic
904813016 1:33176153-33176175 GCATGGACAGGAAGGCAGCTGGG - Intronic
905999766 1:42414337-42414359 GGATGGAAATCAGTACACCTTGG - Intronic
907307897 1:53523694-53523716 GGAGGGACAGGACTGCAGCTGGG - Intronic
908343924 1:63211743-63211765 GTATGGATATGAATGCAGGTAGG - Intergenic
908421605 1:63963808-63963830 GGATGGAGAGGAGAGCAGCGGGG - Intronic
911273281 1:95829564-95829586 GGATGGAAATGACTACAGCTTGG + Intergenic
912619322 1:111139782-111139804 GGGCGGGGATGAGTGCAGCTGGG - Exonic
913430082 1:118781022-118781044 GGATGGAGCCCAGTGCAGCTTGG - Intergenic
913601865 1:120429028-120429050 GGATGGAAATGAGTGGAGAGTGG - Intergenic
913992554 1:143627989-143628011 GGATGGAAATGAGTGGAGAGTGG + Intergenic
914085178 1:144447575-144447597 GGATGGAAATGAGTGGAGAGTGG + Intronic
914588996 1:149089553-149089575 GGATGGAAATGAGTGGAGAGTGG + Intronic
915799645 1:158776418-158776440 GGATGGAAATGTGTGGACCTAGG + Intergenic
918152689 1:181811830-181811852 GTATGGGCATGAGTGCTTCTTGG + Intergenic
918444461 1:184603182-184603204 GCATGCTCATGACTGCAGCTGGG - Intronic
918752019 1:188284837-188284859 GGATGGATTTGAGTGAATCTTGG - Intergenic
919032077 1:192254579-192254601 GCAGGGACATGAATGAAGCTGGG - Intergenic
919755351 1:201062827-201062849 GGATGGACATGAGTGCAGCTTGG + Intronic
920953877 1:210599662-210599684 GGAAAGAAATGAGAGCAGCTTGG - Intronic
924040760 1:239981686-239981708 GGATTGACATGGGGGCAGATAGG - Intergenic
1062780303 10:198895-198917 GAATTGACATGATTGAAGCTGGG + Intronic
1063629716 10:7722425-7722447 GGATGGTCAGGAGTCCAGCTGGG + Intronic
1064753640 10:18556124-18556146 GGATGGACATGAATGGAGAATGG + Intronic
1064755673 10:18570193-18570215 GGATGGACATGAATGGAGAATGG - Intronic
1064849901 10:19698890-19698912 GCAGGGACATGGGTGAAGCTGGG + Intronic
1065319276 10:24494106-24494128 GCATAGAAATGTGTGCAGCTAGG + Intronic
1068359132 10:55953152-55953174 TGATAGACATGAATGCAGCTTGG - Intergenic
1068538727 10:58268333-58268355 GGAGGGAGTTGAGTGCAGTTAGG - Intergenic
1069601055 10:69708394-69708416 GGTTGGAGAGGAGTTCAGCTGGG + Intergenic
1072328114 10:94318592-94318614 GGATGGACACAATTTCAGCTTGG - Intronic
1072967141 10:99983413-99983435 GGAAGGAAATGAGAGAAGCTAGG + Intronic
1073801679 10:107048030-107048052 GCAGTGACATGATTGCAGCTCGG - Intronic
1074324901 10:112440648-112440670 AGATCGACATGAGTGCAGCCCGG - Exonic
1075005159 10:118824852-118824874 AGATGCACTTGAGTGCAGTTTGG - Intergenic
1075426564 10:122346419-122346441 GGCTGGAGATGTGGGCAGCTGGG + Intergenic
1075443544 10:122498251-122498273 GAATGGACAGGAGGGCAGCAGGG - Intronic
1076256799 10:129033053-129033075 GAAGGGACATGAATGCAGCTGGG - Intergenic
1081374204 11:42339799-42339821 GGCTGGAAAAGAGTTCAGCTGGG + Intergenic
1082988725 11:59189171-59189193 GGATCCTCATGAGTGCAGCGGGG + Exonic
1083156616 11:60827271-60827293 GGATGGAGGAGAGAGCAGCTAGG - Intergenic
1084693294 11:70739281-70739303 GGGTGGAGATGAGTGGAGATGGG - Intronic
1084707943 11:70826558-70826580 GGAAGGACAGGCGTGCAGCCCGG + Intronic
1084711550 11:70846994-70847016 GGATGGGCAGGACTGCAGCTGGG + Intronic
1086786838 11:90979494-90979516 GCAGGGACATGAGTGGAGCTGGG - Intergenic
1088517458 11:110653912-110653934 GCATGGACATGGATGGAGCTGGG + Intronic
1088828758 11:113517375-113517397 GGATGGACAGGAGTGCAAGTAGG - Intergenic
1089357162 11:117861553-117861575 GGACGGAGCTGAGTGCAGCCTGG + Intronic
1091049710 11:132356256-132356278 GGTTGGACAGAAGTGCAGGTTGG + Intergenic
1091125619 11:133092916-133092938 GGATGAGAATGGGTGCAGCTGGG - Intronic
1096012463 12:48231724-48231746 GCAGGGACATGAATGGAGCTAGG - Intergenic
1097778512 12:63675760-63675782 GGATGGAAATGACTGCAAGTGGG - Intergenic
1099623435 12:85034047-85034069 GGTTGGTCATGACAGCAGCTGGG + Intronic
1099723899 12:86399609-86399631 GGATAGACATGATTGAAGCAAGG - Intronic
1101087366 12:101250000-101250022 GGATGGTCATGAGTAAAACTAGG - Intergenic
1101209817 12:102524588-102524610 GGATGTATTTGAGTGCTGCTTGG + Intergenic
1102124658 12:110470075-110470097 GGATGGCCATGGGTGCAACAGGG - Intronic
1104812986 12:131629414-131629436 GGAGGGTCATGAGTACAGCTGGG - Intergenic
1106029896 13:25990553-25990575 GGATGGCCATGTGGCCAGCTGGG + Intronic
1106873060 13:34042737-34042759 GGCTGAACATGAGTTTAGCTGGG + Intergenic
1118489600 14:66246344-66246366 GCAGGGACATGGGTGAAGCTGGG + Intergenic
1119593008 14:75907908-75907930 AGATGGACATGAGTACTTCTTGG - Intronic
1121335870 14:93077154-93077176 TAGAGGACATGAGTGCAGCTTGG - Intronic
1126135510 15:45386522-45386544 GTATGGACATGAGAGGAGCCAGG - Intronic
1126158536 15:45587436-45587458 GGAGGGACATGAGTGTCCCTGGG + Exonic
1126456700 15:48870295-48870317 GGATGGAAAAGAGTCCAGATAGG + Intronic
1127707356 15:61560393-61560415 GGATGGACAGAAGTTCAGGTAGG + Intergenic
1127848809 15:62895449-62895471 GGAGGGACATGGATGCATCTTGG + Intergenic
1130034884 15:80349860-80349882 GCCTGGAAATGAGTTCAGCTGGG - Intronic
1130939664 15:88497125-88497147 GGATGGTCAGGAGTGCTGGTGGG - Intergenic
1132746214 16:1437359-1437381 GGATGGGAATGAGTGCGGATGGG + Intronic
1136285427 16:29237672-29237694 GGATGCACCTGATAGCAGCTGGG + Intergenic
1137892647 16:52178721-52178743 GGATGGACATGAGCACAGCATGG + Intergenic
1140872949 16:79123405-79123427 GAGTGGAAATGAGGGCAGCTGGG + Intronic
1141449659 16:84089728-84089750 GCATGGACATGGGTGAAACTAGG - Intronic
1142090754 16:88207804-88207826 GGATGCACCTGATAGCAGCTGGG + Intergenic
1142501701 17:336705-336727 GGACGGCCTTGAGGGCAGCTAGG - Intronic
1143235003 17:5392177-5392199 GGATGGGCATGGGAGCCGCTAGG - Intronic
1143517141 17:7425605-7425627 GGATTGGCATGAGTGCAGTGTGG + Exonic
1143728438 17:8865960-8865982 AGATGGCGATGACTGCAGCTTGG + Intronic
1146184762 17:30717546-30717568 GGAAGGAGGTGAGGGCAGCTGGG - Intergenic
1146945688 17:36871932-36871954 GGATGGAGATGGGAGCAGATTGG - Intergenic
1151010107 17:70484096-70484118 GGAAGTACCTGAGGGCAGCTAGG - Intergenic
1151429688 17:74053903-74053925 GGATGGCTATGACAGCAGCTTGG + Intergenic
1157242344 18:46022962-46022984 GCAGGGACATGGGTGGAGCTGGG + Intronic
1157730893 18:50003204-50003226 GGATGGACCTGAGTGGATGTGGG + Intronic
1157788481 18:50508021-50508043 AGAAGGACAAGAGTGAAGCTGGG - Intergenic
1159029733 18:63218726-63218748 GGATGGAGATGAGTGGAGGATGG - Intronic
1159080692 18:63731974-63731996 CCATGGACATGCCTGCAGCTTGG + Intergenic
1160302346 18:77694786-77694808 GGATGGAAATCAGAGCAGCGTGG - Intergenic
1160822625 19:1065596-1065618 GTGTGGACATGTGTGCAGCCTGG - Intergenic
1163048280 19:14661396-14661418 GCAAGGACAGGAATGCAGCTGGG - Intronic
1163255827 19:16155248-16155270 TGATGGACATCAGTGGAGGTGGG + Intronic
1165259300 19:34598604-34598626 GTAGGGGCAAGAGTGCAGCTGGG + Intronic
1165992215 19:39822927-39822949 GGGTGGACAGGAGTGAAGGTGGG + Intergenic
1167836268 19:52073763-52073785 TGATGGACATGAATGTAGATAGG + Intronic
925157868 2:1661152-1661174 GGATGGATCTGAGCGCAGCCTGG - Intronic
925751691 2:7095375-7095397 GGATGGAGATGAGTGCATTTGGG + Intergenic
930235947 2:48889105-48889127 GCATGGACATGAGTGCTGTAAGG - Intergenic
931201533 2:60102126-60102148 GGATAAACATGTGTGCAACTAGG + Intergenic
933550053 2:83764979-83765001 GGAGGGACATGGATGAAGCTAGG - Intergenic
935678539 2:105617032-105617054 GGAAGGGGATGAGGGCAGCTAGG - Intergenic
936250877 2:110867197-110867219 GAGTGGACAGGAGTGAAGCTTGG + Intronic
938072428 2:128315756-128315778 AGGTGGACCTCAGTGCAGCTTGG + Intronic
939253859 2:139718105-139718127 AGATGGAAATGAGTCCAGCATGG + Intergenic
940887505 2:159002204-159002226 GTGTGGACATGAGTTCAGCCTGG + Intronic
941042858 2:160642756-160642778 GCAGGGACATGGATGCAGCTGGG - Intergenic
942406357 2:175660561-175660583 GGATGGACTTGTCTGGAGCTTGG + Intergenic
943181911 2:184555484-184555506 ACACGGACATGAGTGCAGATAGG - Intergenic
944226243 2:197351350-197351372 GGATCGAGATGAGTCCAGTTGGG + Intergenic
948219905 2:236261359-236261381 GGAAGGAGATGAGTCTAGCTGGG - Intronic
948864769 2:240769614-240769636 GGATGGAGAGGTGTGCAGCGGGG - Exonic
1171325708 20:24290547-24290569 GAATGGAATTGAGTGCAGCCTGG + Intergenic
1171400789 20:24871997-24872019 GGAGGGACAGGAGAGGAGCTGGG + Intergenic
1172129313 20:32645303-32645325 GGCTGCACCTGAGGGCAGCTGGG - Intergenic
1173333597 20:42095895-42095917 GGATGAAATTGAGTGCACCTTGG - Intronic
1173810058 20:45950052-45950074 GACTGGACTGGAGTGCAGCTGGG + Exonic
1176091537 20:63320581-63320603 GCATGGCCCTGAGTGCAGCCAGG - Intronic
1177217735 21:18151306-18151328 GGATAGGCATGACTGCAGCATGG - Intronic
1177841320 21:26236897-26236919 GGATGGACAGGAGTGTGGTTGGG - Intergenic
1179785949 21:43729617-43729639 GAATGCACATGAGGGGAGCTAGG + Intronic
1181345637 22:22218653-22218675 GGCTGGACATGTGTGGAGCCAGG - Intergenic
1181488366 22:23245702-23245724 GGATGGACATCAGTACCGCCTGG - Intronic
1182285603 22:29245217-29245239 GTATGGACATGAGCTGAGCTGGG + Intronic
1183075924 22:35426678-35426700 GGGTAGACATCAGAGCAGCTGGG + Intergenic
1184920852 22:47604772-47604794 TGATGGACAGGAGGGCAGCAGGG + Intergenic
1184980355 22:48091162-48091184 AGATGAACATTAGTTCAGCTTGG - Intergenic
1185347963 22:50318801-50318823 GGCTGGACATGAAGCCAGCTGGG - Intronic
949485837 3:4536988-4537010 TGAAGGACAGGAGTGCAGCAGGG + Intronic
950873049 3:16245697-16245719 GGAAGGGCAGGGGTGCAGCTGGG + Intergenic
962720446 3:138169140-138169162 TGATGGGCATGAGTGCAGTCAGG + Intronic
963900304 3:150727060-150727082 GTCTGGACAAGAGTGCAGCTGGG + Intergenic
965642176 3:170840759-170840781 TGATGGACATCTGTTCAGCTTGG - Intronic
966420523 3:179730019-179730041 GGAAGGTCATGAGTGCTGGTAGG + Intronic
969575569 4:8034327-8034349 GGATGCACATGGGTGCAGGTAGG + Intronic
970913218 4:21303676-21303698 GGATGGACATGAAGGAAGCCAGG - Intronic
971466632 4:26970538-26970560 GCAGGGACATGGATGCAGCTGGG - Intronic
972101714 4:35428220-35428242 GGATGGACATGAGTATACCTGGG - Intergenic
974154295 4:58051049-58051071 GTATGAACCTGAGTGCTGCTTGG - Intergenic
975598858 4:76078425-76078447 GAATGTACCAGAGTGCAGCTTGG - Intronic
975951814 4:79783031-79783053 GGATCTTCATGAGTGCAACTTGG - Intergenic
978294349 4:107186285-107186307 TGATGGAGATGAGGGCTGCTGGG + Intronic
981534453 4:145784523-145784545 AGATGGAAATGTGTTCAGCTGGG - Intronic
981589058 4:146336730-146336752 GGATGGAGATCAGTGCAGAGGGG + Intronic
981723487 4:147824647-147824669 GGATGGAGTTGAGTGCAGGCAGG + Intronic
981944682 4:150327391-150327413 GCCTGGACAAGAGTGCAGCCTGG + Intronic
983395859 4:167195044-167195066 GGATGGGCGTGAGTCCTGCTGGG + Intronic
983631765 4:169856660-169856682 AGATGTACATGAGTTCAGTTGGG + Intergenic
983995652 4:174178557-174178579 GGCTGGACATGAGAGCATCAAGG - Intergenic
985874260 5:2583455-2583477 TGATGGACATTAGCGGAGCTGGG - Intergenic
986052092 5:4099600-4099622 GGATGGGGGTGTGTGCAGCTCGG - Intergenic
988325523 5:29761686-29761708 GGAAGGACCTGAGTGCAGCAGGG - Intergenic
990247057 5:53873666-53873688 TGATGGACAAGAGTTCAGCAAGG - Intergenic
994045882 5:95309151-95309173 GGATGGGCATGAGTGAAGCAGGG - Intergenic
994225605 5:97249014-97249036 GCAGGGACATGAATGCAGCTGGG + Intergenic
995018960 5:107345918-107345940 GGATGTACATGTGTGTAGCTTGG + Intergenic
996890346 5:128411512-128411534 GGTTGGAGAGGAGTTCAGCTGGG - Intronic
1001524292 5:172417693-172417715 TGATGGGCATGGGTGCTGCTAGG - Intronic
1002300529 5:178255141-178255163 GGAGGGGCATGCGTGCAGCCTGG - Intronic
1002494025 5:179599689-179599711 GGATGGAGCTGACTGCAGCCTGG + Intronic
1002865111 6:1115035-1115057 GGAAGGACATTACTGCAGCTGGG - Intergenic
1003111915 6:3258313-3258335 CCATGTACATGACTGCAGCTTGG + Intronic
1003242191 6:4354369-4354391 ATATGGACACGAGTCCAGCTTGG + Intergenic
1006415898 6:33903757-33903779 TGATGGACATGAGTGCATAGGGG - Intergenic
1007706353 6:43793727-43793749 GGCTGGCCAGGAGAGCAGCTGGG - Intergenic
1007800221 6:44385965-44385987 GCAAGGACAGGAATGCAGCTGGG + Intergenic
1011706862 6:90009529-90009551 GGATGTACATCAATTCAGCTGGG - Intronic
1012159982 6:95872575-95872597 GCAGGAACATGAGTGTAGCTGGG + Intergenic
1012612731 6:101235728-101235750 GGATATACAGGAGTGGAGCTTGG + Intergenic
1016042215 6:139442831-139442853 GGATGGAAATGTTAGCAGCTGGG + Intergenic
1016633977 6:146266584-146266606 GGTTGGAGATAAGTGAAGCTGGG - Intronic
1017847759 6:158274315-158274337 AGAGGGACAAGAGAGCAGCTGGG - Intronic
1018079124 6:160243665-160243687 GGATGATCATGAAGGCAGCTGGG + Exonic
1019032377 6:169024363-169024385 GGATGGGCTGGAGTGCAGCCGGG + Intergenic
1019436469 7:1024860-1024882 GGATGGGCATGTGTGACGCTGGG - Intronic
1020115320 7:5472983-5473005 GGATGGGAATGTGTGCAGCGAGG - Intronic
1023604883 7:41920872-41920894 GGATTGGCAGGAGTGCAGCTGGG + Intergenic
1023990814 7:45127236-45127258 AGCTGGACAGGAGTGCAGCCTGG - Intergenic
1024387640 7:48771440-48771462 AGATGCACATGAGTGCCTCTTGG - Intergenic
1028130655 7:87168971-87168993 GGATGGACATAGATGCAGGTAGG - Intronic
1028513930 7:91655919-91655941 GGATGGATATGAATGGAGCTGGG - Intergenic
1032341913 7:131081809-131081831 GGAGGGAAATGAGTGGGGCTAGG + Intergenic
1033738572 7:144249886-144249908 GAATGGACAAGTGTGCTGCTGGG + Intergenic
1033744478 7:144301068-144301090 GAATGGACAAGTGTGCTGCTGGG - Intergenic
1037949005 8:23006857-23006879 GGCGGGAGATGAGTGCAGCTCGG - Exonic
1040893898 8:52345582-52345604 GGTTGGAGATGAAGGCAGCTGGG - Intronic
1041117244 8:54551822-54551844 GCATGAGCATCAGTGCAGCTCGG - Intergenic
1042175268 8:66032323-66032345 TGTGGGACCTGAGTGCAGCTGGG + Intronic
1043507708 8:80919199-80919221 GGGTGGACATGAGTCAAGCCAGG - Intergenic
1046632389 8:116633977-116633999 GGCAGGAGATGACTGCAGCTAGG - Intergenic
1046799112 8:118405526-118405548 GGATGCACATGGGAGCCGCTGGG + Intronic
1049343031 8:142123947-142123969 GGATGAAGATGAGAGCAGCAAGG + Intergenic
1049939818 9:534912-534934 GGATGGAGATGGGTGGAGGTTGG + Intronic
1050605096 9:7292825-7292847 GGATTGACAAGTGTGAAGCTGGG + Intergenic
1056848261 9:90058868-90058890 TGAGGGACATGAGGGCAGCCCGG + Intergenic
1057413036 9:94835215-94835237 GGTTGGACAAGAGTCTAGCTAGG + Intronic
1060406394 9:123375139-123375161 GGATGGGCAGCAGAGCAGCTGGG + Intronic
1061001126 9:127903661-127903683 GGAGGGCCATGGGTGGAGCTTGG - Intronic
1062053608 9:134459479-134459501 GGCTGGGTATGGGTGCAGCTAGG + Intergenic
1062093256 9:134689679-134689701 GGATGGACGTGAGACCAGCCAGG - Intronic
1062185011 9:135213450-135213472 GGATGGAGGGGAGGGCAGCTGGG + Intergenic
1062453754 9:136626420-136626442 GGATGGACATGGTTGGAGCTCGG - Intergenic
1188985375 X:36764103-36764125 GGATGTACATGGGTACAGATTGG - Intergenic
1190177332 X:48161724-48161746 AGATGGACTTGTGTGCACCTGGG + Intergenic
1190946443 X:55098834-55098856 GCAAGGACACCAGTGCAGCTGGG - Intronic
1191597455 X:62961054-62961076 GCAAGGACATGAATGAAGCTGGG - Intergenic
1192148622 X:68698190-68698212 TGAAGGACATGGGTTCAGCTTGG + Intronic
1196811558 X:119632976-119632998 AGAAGGACATGAGTGGAGCTGGG - Intronic
1197040581 X:121931223-121931245 GCATGAACATGAATGGAGCTGGG + Intergenic
1198596011 X:138236575-138236597 GTATGGACATGGATGAAGCTGGG + Intergenic
1202092813 Y:21211803-21211825 GCAGGGACATGAATGAAGCTGGG + Intergenic